Open Access

Genome-level identification, gene expression, and comparative analysis of porcine β-defensin genes

  • Min-Kyeung Choi1,
  • Minh Thong Le1,
  • Dinh Truong Nguyen1,
  • Hojun Choi1,
  • Won Kim1,
  • Jin-Hoi Kim1,
  • Jungwan Chun2,
  • Jiyeon Hyeon2,
  • Kunho Seo2 and
  • Chankyu Park1Email author
BMC Genetics201213:98

DOI: 10.1186/1471-2156-13-98

Received: 6 March 2012

Accepted: 19 July 2012

Published: 15 November 2012

Abstract

Background

Beta-defensins (β-defensins) are innate immune peptides with evolutionary conservation across a wide range of species and has been suggested to play important roles in innate immune reactions against pathogens. However, the complete β-defensin repertoire in the pig has not been fully addressed.

Result

A BLAST analysis was performed against the available pig genomic sequence in the NCBI database to identify β-defensin-related sequences using previously reported β-defensin sequences of pigs, humans, and cattle. The porcine β-defensin gene clusters were mapped to chromosomes 7, 14, 15 and 17. The gene expression analysis of 17 newly annotated porcine β-defensin genes across 15 tissues using semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) showed differences in their tissue distribution, with the kidney and testis having the largest pBD expression repertoire. We also analyzed single nucleotide polymorphisms (SNPs) in the mature peptide region of pBD genes from 35 pigs of 7 breeds. We found 8 cSNPs in 7 pBDs.

Conclusion

We identified 29 porcine β-defensin (pBD) gene-like sequences, including 17 unreported pBDs in the porcine genome. Comparative analysis of β-defensin genes in the pig genome with those in human and cattle genomes showed structural conservation of β-defensin syntenic regions among these species.

Keywords

Antimicrobial peptide β-defensins Pigs pBD Pig genome SNP

Background

Defensins are a large family of cationic cysteine-rich antimicrobial peptides (AMPs) with molecular masses ranging from 2 to 6 kDa; they function as some of the earliest mediators of host defenses in various species of insects, plants, and animals [15]. They have a broad spectrum of antimicrobial activity, ranging from bacteria to fungi and some viruses [6]. Defensins are also thought to play a role in connecting innate and adaptive immune responses in higher organisms; they act as signaling molecules in the immune system and chemoattractants for T-lymphocytes and immature dendritic cells [7]. Having both antimicrobial and immunomodulation activity, they are also called “host defence peptides” [8].

Defensins are highly conserved in their structure like defensin fold and function from Drosophila to higher mammals [4, 6, 911]. At the sequence level these peptides are remarkably diverse and this appears to have been driven by varying selective pressures and recurrent duplication in mammals [12]. In spite of these interesting features, the functions of most defensins in any organism have not been studied in detail.

On the basis of differences in their size, disulfide bond patterns which are well conserved and related defensin fold, mammalian defensins are classified into α, β, and θ sub-classes [5]. The β-defensins are defined by a 6-cysteine motif, C-X6-C-X4-C-X9-C-X6-C-C, where X represents any amino acid residue, and by a large number of basic amino acid residues in their active peptide regions [13, 14]. In most cases, their coding sequences consist of 2 exons. The first exon includes the 5′-untranslated region and the leader domain of the preproprotein; the second exon encodes the mature peptide with the 6-cysteine domain [2].

The availability of genomic sequence information has enabled the characterization and comparative analysis of β-defensin repertoires among various species, including humans, chimpanzees, mice, rats, dogs, and chickens [1418]. Although the role of β-defensins in general immunity against pathogens could be important, limited results are available to elucidate the complete β-defensin repertoire in the pig genome [19, 20].

In this study, we characterized 29 functional β-defensin genes in the pig genome on the basis of sequence homology to previously reported β-defensin genes and the conserved 6-cysteine motif. We compared the evolutionary conservation of β-defensin genes among humans, cattle, and pigs, and analyzed their expression patterns. We also report SNPs in the mature peptide region of porcine β-defensin genes.

Methods

Identification, annotation, and mapping of porcine β-defensin genes

A BLAST analysis was performed against the high-throughput genome sequences (HTGS) database of Sus scrofa at the National Center for Biotechnology Information (NCBI, http://​www.​ncbi.​nlm.​nih.​gov/​) using the previously reported nucleotide sequences of 57 human (DEFB 110, -112, -113, -114, -133, -1, -4, -103, -104, -105, -106, -107, -130, -131, -132, -134, -135, -136, -137, -115, -116, -118, -119, -121, -123, -124, -125, -126, -127, -128, -129, -132), cattle (BBD4, -5, -7, -10, -103A, -103B, -119, -122, -122A, -123, -124,-300, EBD, TAP, LAP), and pigs (pBD1, -2, -3, -4, -104, -108, -114, -123, -125 and -129) β-defensins. Matches with > 70% sequence identity were retrieved and aligned using the ClustalW2 program (http://​www.​ebi.​ac.​uk/​Tools/​msa/​clustalw2/​). The exon-intron boundaries were determined by comparing the genomic sequences to available cDNA and EST sequences of human and porcine β-defensins at the NCBI. The GT-AG rule [21] was applied for the prediction of splice junctions when they were not available. The newly described porcine β-defensins were annotated based on nucleotide sequence identity to reported human β-defensins. The nucleotide sequences of identified porcine β-defensins were aligned to the porcine genome assembly (Sscrofa10.2; [22]) using BLAST to determine their positions in the pig genome. The official gene symbols for porcine β-defensins are DEFBs following the assignment of HUGO Gene Nomenclature Committee (HGNC). However, the conventional abbreviation of porcine β-defensins, pBDs, is used here for consistence with previous publications and distinguishing from abbreviations of human β-defensins.

Phylogenetic analysis

Nucleotide sequences of predicted β-defensin genes were translated in all 6 reading frames using the CLC Main Workbench 5 (CLC bio, Denmark). Amino acid sequences corresponding to correct open reading frames were aligned using ClustalW2 using GONNET Matrix [23] with gap open and extension penalties of 7 and 0.2, respectively. Phylogenetic analyses were performed using MEGA version 5.1 [24]. The evolutionary distances were computed using the JTT matrix-based method [25].

Preparation of RNA and RT-PCR

Tissues were collected from a 2-week-old and 5-month-old NIH miniature pigs, snap-frozen in liquid nitrogen, and stored at -70°C until use. Total RNA was extracted from small intestine, tongue, eye, cerebrum, spleen, kidney, liver, lung, stomach, testis, muscle, skin, rectum, trachea, and thymus tissues using the RNAiso-PlusTM Reagent (TAKARA, Japan) according to the manufacturer’s instructions. Isolated RNA was subjected to RNase-free-DNaseI treatment (Qiagen, USA) to remove genomic DNA contaminants and was visualized on a 2% formaldehyde agarose gel. Reverse transcription was performed in a 25-μl reaction volume using oligo-(dT)15 and SuperScript® III Reverse Transcriptase (Invitrogen, USA) for 50 min at 50°C and inactivated for 15 min at 72°C. For semi-quantitative RT-PCR, 1 μl of the reverse transcription reaction product was used for each tissue in a 15-μl reaction mixture with 10 pmol of each primer (Table 1), 200 μM dNTPs, 0.5 U of SuperTerm® Taq polymerase (LPI, UK), and PCR buffer [10 mM Tris (pH 8.3), 50 mM KCl, and 1.5 mM MgCl2]. PCR conditions consisted of 36–42 cycles of 94°C for 30 sec, 56–68°C for 30 sec for primer annealing (Table 1), and 72°C for 30 sec for extension with an initial denaturation step at 94°C for 5 min and a final extension at 72°C for 10 min with a T-3000 thermocycler (Biometra®, Germany). Density values were standardized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using the primer set: 5′-GCTACACTGAGGACCAGGTTG-3′ and 5′-AGGAGATGCTCGGTGTGTTG-3′. The amplified products were confirmed by sequence analysis to ensure target specificity.
Table 1

Polymerase chain reaction (PCR) primers used for the amplification of porcine β-defensin genes by RT-PCR

 Gene

Accession

Nucleotides

Primer sequences (5′-3′)

A.T.b

E.P.c

symbol

 number

 position

(°C)

(bp)

pBD105

FP102601.2

20573-25396

F - CTCAATTTACATCAGGGTGC

60

135

R - ACAACCTTCTCGTCCTCAGT

pBD112

CU041392.3

49146-58607

F - TGTGTAGACGGAAGCTTGAG

60

244

R - GTCACATTCTCTCATGCAGC

pBD4a

63852-70272

F - GTGGCTTGGATTTGAGGAGAGAGT

58

232

R - AGTGATACACAGGCCTGGAAGGAT

pBD114

94921-105728

F - ACCTTGGTGGATCCTGAACGATGC

64

128

R - TCAAACGCCCTCTGAATGCAGCA

pBD133

111793-117208

F - GTGCCATGAAAGACACCTAT

60

125

R - CAGACTTCTCCATGCAACAG

pBD108a

CU442750.3

1195-6843

F - GACGATTGTCATTCTTCTGATCCTGG

58

258

R - TAGGTTGACTTGTGGTGCCCGAAA

pBD116

21853-26511

F - CTGATCCTGGTTCATAAGAC

60

211

R - GAATCCTCCTTCTCGTTAG

pBD118

75980-87519

F - CTGTTCCTACCACAAGTGAT

60

184

 

R - GTGCGAGAAGTGACAGTATT

pBD119

89342-101888

F - CTGTTTCTTGCCATCCTT

56

168

 

R - TACATAGGACTGGAGGCAGC

pBD122

125631-133938

F - GCTGCACTATTGCTCTTGTC

62

158

 

R - TCACACAGCACAGTTTACCA

pBD123

143565-150992

F - TGGAATCTTCACGGCAAAT

68

100

 

R - TGATACTTGGGCTTCACACA

pBD124

158778-164429

F - CTTCTGCTTATTGTGGCTCT

56

187

 

R - ATCTTGGCCATCTTGAGTC

pBD115

CU627978.3

88572-92708

F - CTTAGCTGTCCTTGTGGTCC

64

227

R - CAAGCCTTAGCTGTACTTGC

pBD128

18063-21789

F - GGTTCTCATTATCCTGCTGT

60

258

R - TGTGTTCACTGTGACAGTGG

pBD129 a

CU606854.2

119234-124263

F - CAAAGACCACTGTGCCGTGAATGA

58

239

R - TTGATGCTGGCGAAAGGGTTGGTA

pBD3 a

  

F - CTTCCTATCCAGTCTCAGTGTTCTGC

58

308

  

R - GGCTTCTGTAGACTTCAAGGAGACAT

pBD104 a

  

F - TCCTTCCACGTATGGAGGCTTGTT

58

332

  

R - TTACAATACCTCCGGCAGCGAGAA

a[19].

b Annealing temperature.

c Expected product size.

Cloning and sequencing

PCR products were gel-purified using the QIAquickTM Gel Extraction kit (Qiagen, Germany) and ligated into pGEM-T Easy Vector (Promega, USA). The ligation products were electroporated into DH10B cells (Invitrogen, USA) using a MicroPulserTM (Biorad, USA). Transformed bacteria were plated onto agar containing 50 μg/ml ampicillin, 40 mg/ml X-gal solution, and 100 mM IPTG. The plasmids were isolated using the Plasmid SV Miniprep Kit (GeneAll Biotechnology, Korea). Sequencing reactions were performed using ABI PRISM BigDyeTM Terminator 3.1 using T3 and SP6 universal primers. The products were analyzed on an automated DNA Analyzer 3730XL (Applied Biosystem, USA).

Analysis of nucleotide polymorphisms

Single nucleotide polymorphisms (SNPs) of β-defensin genes were identified from the sequence analysis of the genomic PCR products from 14 animals consisting of 7 breeds, including Landrace, Yorkshire, Berkshire, Duroc, Korean native pigs, Seoul National University (Minnesota) miniature pigs [26, 27], and NIH miniature pigs. PCR primers for the amplification of β-defensin exon 2 were designed using primer 3 (http://​primer3.​sourceforge.​net) ( Additional file 1). The allelic frequency of the identified SNPs was estimated from further genotyping of a total of 35 animals by either PCR-RFLP (Table 2) or sequence analysis of PCR products for identified SNPs.
Table 2

Identified nucleotide polymorphisms in the porcine β-defensin exon 2 region

Gene

SNP positiona

Nucleotide

Amino acidb

RFLP

MAFc

pBD1

171

A/G

/

BstN I

0.177

pBD4

65

G/A

R/K

EcoR V

0.451

pBD113

114

A/G

/

-

0.029

pBD114

186

G/A

/

-

0.09

pBD115

144

A/T

Q/H

-

0.057

pBD115

291

G/A

/

-

0.043

pBD121

96

G/A

/

Pci I

0.2

pBD133

196

A/C

K/Q

-

0.043

a The numbering starts from the translation start codon.

b Nonsynonymous changes are indicated by single letter code.

c MAF, minor allele frequency; 35 pigs of 7 breeds (Landrace, Yorkshire, Berkshire, Duroc, Korean Native Pig, Seoul National University miniature Pig, and NIH miniature pig) were used for genotyping.

Results and discussion

Identification of 27 porcine β-defensin genes

A BLAST analysis was used to align the pig genomic sequence from NCBI with 57 previously reported β-defensin cDNA sequences from cows, humans, and pigs. We identified 27 matches with >50% sequence coverage and >70% identity to any known β-defensin sequence. In addition, we identified 2 β-defensin genes with relatively lower sequence coverage but higher identity, pBD112 (32% and 81%, respectively) and pBD125 (42% and 86%, respectively). The identified putative β-defensin sequences were translated into peptide sequences to determine the open reading frames (ORFs) that contain the 6-cysteine motif, a major characteristic of β-defensins peptides. As a result, we determined 29 ORFs satisfying our criteria for porcine β-defensins, including 17 previously unreported genes (pBD105, -106, -112, -113, -115, -116, -118, -119, -122, -123, -124, -128, -130, -131, -133, -134 and -135), 10 reported genes (pBD1, -2, -3, -4, -104, -108, -114, -121, -125 and -129) and 2 partial genes (pBD117 ψ and -127 ψ) that lacked sequences corresponding to the exon 1 region ( Additional file 2). It was difficult to determine with confidence whether the lack of exon 1 region from pBD117 ψ and -127 ψ was due to a deletion in the pig genome or to an incomplete pig genomic sequence. However, RT-PCR results using specific primers for pBD117 ψ and -127 ψ did not show any evidence of mRNA expression, supporting that these genes are nonfunctional (data not shown). All porcine β-defensins contained abundant positively-charged amino acid residues, such as lysine (K) and arginine (R) (Figure 1).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2156-13-98/MediaObjects/12863_2012_Article_1035_Fig1_HTML.jpg
Figure 1

Comparison of amino acid sequences among 29 porcine β-defensin genes. Amino acid sequences were predicted from cDNA sequences and aligned using ClustralW2 with minor manual manipulations to maximize sequence alignment. The 6-cysteine motifs are shaded. The 9 significantly conserved sites, including the 6-cysteine motif, are indicated at the bottom.

One way to identify defensins from genome sequence information is to use gene prediction algorithms like the HMM (Hidden Markov Model) that incorporate homology profiling [14, 15, 17, 28]. Although these methods are accurate and easy to use, they usually do not support the identification of a complete list of defensin genes because of inadequate accommodation of the sequence diversity of β-defensins in the sequence homology profile. Therefore, we chose the manual analysis method using NCBI blast analysis.

Comparative study of porcine β-defensin genes using phylogenetic analysis

To annotate the putative β-defensin-encoding sequences identified from our analysis, a phylogenetic analysis was performed using 113 amino acid sequences corresponding to the β-defensin prepropeptide, including signal and mature peptide regions, together with previously reported β-defensins from humans and cattle (Figure 2). We annotated porcine β-defensin genes on the basis of sequence similarity and phylogenetic relationships to previously described β-defensins in humans to maintain consistency in the comparative analysis of β-defensins with other species. The results showed that the nomenclature of 10 previously reported porcine β-defensin genes were consistent with that of human, except for pBD1–4 and pBD-123. pBD1, -2, -3, and -4, which were more closely related to DEFB4, -1, -103, and -110 in humans, respectively. Since several studies have investigated pBD1–4[19, 2933], it could cause confusion if they were renamed; accordingly, we have maintained their names. However, we suggest renaming previously reported pBD123[19] to pBD121, considering its closer sequence similarity and phylogenetic relationship to human DEFB121 than DEFB123. This change would make the nomenclature of porcine β-defensins consistent with that of other species. As a result, the orthologs of β-defensin123 from humans, pigs, and cattle become clustered together (Figure 2).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2156-13-98/MediaObjects/12863_2012_Article_1035_Fig2_HTML.jpg
Figure 2

A phylogenetic analysis of β-defensin genes among humans, cattle, and pigs. 36 β-defensin genes from humans, 48 from cattle, and 29 from pigs were analyzed using the neighbor-Joining method. The bootstrap consensus tree inferred from 1,000 replicates and branches corresponding to less than 50 % bootstrap replicates were collapsed. The analysis involved 113 amino acid sequences of β-defensin prepropeptides. pBD, β-defensins; BBD, bovine β-defensins; DEFB, human β-defensins. The “ψ” symbol of pBD117ψ and -127ψ indicates Pseudogenes or partial genes. Sequences of human and cattle β-defensin genes [47] were obtained from NCBI.

Although it was difficult to define orthologous relationships for some of the β-defensin genes, interspecies sequence identity between presumptive orthologous β-defensins with the same numbers in their names was higher in most cases than the values between non-orthologus β-defensins within the same species ( Additional file 3). The average nucleotide sequence identity from the 27 pairs of orthologous β-defensins between humans and pigs was 84.38%.

DEFB105 in human consists of 3 exons, in contrast to the typical 2-exon structure of other β-defensin genes [2]. A 1,249 bp nucleotide insertion in exon 2 changed the single exon to 2 exons in DEFB105[28]. The porcine orthologous gene, pBD105, also consists of 3 exons in the same configuration, suggesting that the insertion event occurred in the common ancestor of humans and pigs. This gene was missing in the current bovine genome assembly [34].

Localization of porcine β-defensin genes to chromosomes 7, 14, 15, and 17

The identified 29 porcine β-defensin related sequences were mapped to the pig genome assembly (Sscrofa10.2) using BLAST to determine their location. They were localized to 4 clusters on 4 pig chromosomes, Sus scrofa chromosome (SSC) 7, SSC14, SSC15, and SSC17, with several genes in each cluster (Figure 3). By comparing the available gene annotations for humans and cattle at NCBI with our mapping results on porcine β-defensin genes, we identified the β-defensin-containing syntenic regions for the 3 species with the help of evolutionarily conserved flanking markers around the β-defensin gene clusters, such as PGK2 and TFAP2D for the SSC7 cluster, pBD135 and -131 for SSC14, AGPAT5 and SPATA4 for SSC15, and ZCCHC3 (LOC100519451) and BCL2L1 for SSC17. For the SSC14 cluster, we directly used the β-defensin genes as evolutionarily conserved markers, since the determination of evolutionarily conserved markers among humans, pigs, and cattle was less clear. Although we further analyzed sequences within these flanking markers for the possible presence of β-defensin-like sequence in the pig genome, no other sequences were found, consistent with the high sequence homology among β-defensin genes ( Additional file 3).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2156-13-98/MediaObjects/12863_2012_Article_1035_Fig3_HTML.jpg
Figure 3

Comparison of β-defensin-containing chromosomal regions among human, pig, and cattle genomes. The evolutionarily conserved flanking markers and the clustered β-defensin genes are shown. The genes with orthologous relationships are indicated by lines among maps of different species. The names of the β-defensin genes are indicated with only numbers without species-specific symbols (DEFB for human, BBD for cattle, and pBD for pigs). Pseudogenes or partial genes identified in the pig genome sequencing results at NCBI are shown as dotted lines. Information from genome build 37.2, Sscrofa10.2, and Btau5.2 were used for humans, pigs, and cattle, respectively. 1Some of the cattle β-defensin genes have less typical names, including TAP, LAP, and EBD.

Using information from previous studies [19, 34, 35] and from the NCBI Map Viewer (http://​www.​ncbi.​nlm.​nih.​gov/​mapview/​), we constructed a comparative map of the syntenic regions of β-defensins among humans, cattle, and pigs (Figure 3). The comparison of the β-defensin syntenic regions among the 3 species showed significant interspecies conservation, including gene orders in the regions, with slight variations specific to each species, supporting the consistency of our annotation of the porcine β-defensin genes. The SSC7 cluster, consisting of pBD133, -114, -113, -4, and -112, was the most conserved region among the clusters. The SSC15 cluster between AGPAT5 and SPATA4 contains 6 β-defensin genes, pBD105, -106, -104, -1, -2, and -130, and the genetic variation within the cluster among cattle, humans, and pigs was somewhat greater than the other regions. For example, the Homo sapiens autosome (HSA) 8 cluster was separated into 2 chromosomes, SSC15 (pBD105, -106, 104, -1, -2, and -130) and SSC14 (pBD135, -134, and -131), in the pig genome. Also, there were gene duplications in the human cluster compared to those of cattle and pigs. Cattle β-defensin genes in the region showed higher sequence variations compared to homologous regions in humans and pigs; thus, the establishment of orthologous relationships with β-defensin genes among humans, pigs, and cattle was not clear for this region. The largest number of β-defensin genes was found in the SSC17 cluster between TRIB3 and BCL2L1 and contained 12 genes, pBD129, -128, -127, -115, -124, -123, -122, -121, -119, -118, -117, and -116, which were separated into 2 sub-clusters in HAS20. In the current Sscrofa10.2 assembly, the chromosomal location of a linked β-defensin gene, pBD3, was not determined although this gene is in contig NW_003613575.1. Considering the positions of the orthologous genes in the human genome, the most likely position of pBD3 in the pig genome is SSC15 (Figure 3).

Absence of α-defensins in the bovine genome was reported previously [36]. Consist to this, there were no α-defensins in the pig genome, suggesting that the α-defensins may not present in the artiodactyla lineage.

Gene expression analysis of 17 newly annotated porcine β-defensin genes

We analyzed the expression pattern of 22 β-defensin genes including 17 newly annotated β-defensin genes together with the 5 previously described genes. To evaluate the patterns of β-defensin expression in pigs, we used respiratory (lung and trachea), digestive (tongue, stomach, small intestine, and rectum), reproductive (testis), primary immune (spleen and thymus), and other (eye, cerebrum, kidney, liver, muscle, and skin) tissues. RT-PCRs were designed to distinguish amplicons between genomic DNA and cDNA templates according to their product size (data not shown). To detect the expression of β-defensin genes on an agarose gel, our RT-PCR profiles consisted of 36 to 42 cycles, which is more than typical semi-quanitative PCR, suggesting that the expression level of β-defensins is relatively low in healthy pigs.

In our tissue panel, semi-quantitative RT-PCR of the 17 newly annotated β-defensins showed detectable amounts of only 11 genes (pBD105, -112, -115, -116, -118, -119, -122, -123, -124, -128, and -133) (Figure 4). The other 6 genes (pBD106, -113, -130 -131, -134, and -135) did not show evidence of mRNA expression from the RT-PCR. Subsequent genomic PCR for these unexpressed genes successfully yielded genomic DNA-specific amplicons (data not shown), suggesting that the amplification failure was indeed due to a lack of expression. Because these non-expressed β-defensins have intact ORFs for the coding regions, further studies are necessary to evaluate the functional importance of these genes, including the induction of gene expression in animals by microbial challenge or analysis in tissues that were not evaluated in this study such as the bone marrow, an immune regulatory organ [37].
https://static-content.springer.com/image/art%3A10.1186%2F1471-2156-13-98/MediaObjects/12863_2012_Article_1035_Fig4_HTML.jpg
Figure 4

Analysis of the tissue expression profiles of 16 porcine β-defensins from 15 tissues using semi-quantitative RT-PCR. GAPDH was used as a control to control for the amount of cDNA and the level of gene expression. (A) The gene expression analysis of β-defensins from a 2-week-old pig. (B) Temporal changes in the gene expression of pBD115 in testes between 2-week-old and 5-month-old pigs. 1, small intestine; 2, tongue; 3, eye; 4, cerebrum; 5, spleen; 6, kidney; 7, liver; 8, lung; 9, stomach; 10, testis; 11, muscle; 12, skin; 13, rectum; 14, trachea; 15, thymus.

The expression patterns of porcine β-defensin mRNAs were consistent with the expected function of β-defensins as antimicrobial peptides. A greater diversity of β-defensins was expressed from the tissues that require strong mucosal defenses, such as the small intestine and lung, and that control the immune system, such as the spleen and thymus (Figure 4). Among porcine the β-defensins, pBD4, -122, and -129 showed strong expression in most pig tissues. The results of our gene expression analysis on 5 previously reported porcine β-defensins genes (pBD4, -104, -108, -114, and -129) were consistent with those of a previous study [19] with only minor differences in the tissue panel.

Interestingly, the kidney and testis expressed the most diverse β-defensins. It has been suggested that β-defensins control the development of the reproductive system [3840]. Our analysis on the temporal expression of pBD115 showed strong expression in the 2-week-old testis but no expression at 5 months (Figure 4B). Other pig β-defensins including pBD108, -116, -118, -119, -122, -123 and 124 in the syntenic region did not show significant differences in their expression pattern between the two different stages (data not shown). The expression pattern in the kidney was opposite to that of the testis, suggesting that expression may be developmentally regulated.

The presence of porcine β-defensin genes within 4 small clusters on 4 chromosomes allowed us to evaluate possible co-regulation of genes closely located within a cluster. However, adjacent pBD114 and -133 showed completely different expression patterns, and pBD4 and -129, on different chromosomes, showed a similar expression pattern (Figures 3 and 4). This suggests that the expression of each β-defensin is independently regulated, even for β-defensins closely located within a cluster.

Identification of single nucleotide polymorphisms

Many studies have suggested possible associations between SNPs within β-defensin genes and disease susceptibility [4145]. To identify cSNPs present in the mature peptide-coding region of porcine β-defensins, we evaluated SNPs in exon 2 region of 20 (pBD1, -2, -4, -104, -105, -108, -112, -114, -115, -116, -118, -119, -121, -122, -123, -124, -125, -128, -129 and -133) porcine β-defensin genes. In doing so, we identified 8 cSNPs from 7 genes. We found 3 nonsynonymous varionts from pBD4, -115 and -133. We searched for restriction enzymes to perform PCR-RFLP on the identified SNPs. Polymorphisms of pBD1, -4, and -121 were distinguishable using Bst NI, Eco RV, and Pci I, respectively. Genotyping was performed for each SNP, and allelic frequencies were estimated (Table 2). It will be interesting to evaluate the possible association between these polymorphisms and innate immunity against pathogens important in pig production.

Conclusions

AMPs are among the most ancient components of the immune system [46], but their extensive role in mammalian defenses [2] and their positive selection throughout evolution [28] have only recently become apparent. We identified 29 porcine β-defensin (pBD) gene-like sequences, including 17 unreported pBDs in the porcine genome. Although the genome-level characterization of porcine β-defensin genes has demonstrated the existence of multiple genes encoding peptides with possible antimicrobial function, further studies will be required to identify their functional differences or specificity. A better understanding of the roles of porcine β-defensin genes could be useful for improving general health or resistance to microbial infections in pigs.

Abbreviations

AMP: 

Anti-microbial peptide

BBD: 

Bovine β-defensin

BTA: 

Bos taurs autosome

EST: 

Expressed sequence tag

DEFB: 

Human β-defensin

GAPDH: 

Glyceraldehyde 3-phospate dehydrogenase

HAS: 

Homo sapiens autosome

HMM: 

Hidden Markov model

HTGS: 

High-throughput genome sequences

pBD: 

Porcine β-defensin

RT-PCR: 

Reverse transcription polymerase chain reaction

SNPs: 

Single nucleotide polymorphisms

SSC: 

Sus scrofa chromosome.

Declarations

Acknowledgments

We appreciate Dr. Yongming Sang, Department of Anatomy and Physiology, Kansas State University, for helpful discussion. This work was supported by Cooperative Research Program for Agriculture Science & Technology Development (PJ009103)" Rural Development Administration, Republic of Korea and by Technology Development Program for Bio-industry, Ministry for Food, Agriculture, Forestry and Fisheries, Republic of Korea.

Authors’ Affiliations

(1)
Department of Animal Biotechnology, Konkuk University, Hwayang-dong
(2)
College of Veterinary Medicine, Konkuk University

References

  1. Ganz T: Defensins and host defense. Science. 1999, 286: 420-421. 10.1126/science.286.5439.420.View ArticlePubMed
  2. Ganz T: Defensins: antimicrobial peptides of innate immunity. Nat Rev Immunol. 2003, 3: 710-720. 10.1038/nri1180.View ArticlePubMed
  3. Ganz T: Defensins: antimicrobial peptides of vertebrates. C R Biol. 2004, 327: 539-549. 10.1016/j.crvi.2003.12.007.View ArticlePubMed
  4. Boman HG: Gene-encoded peptide antibiotics and the concept of innate immunity: an update review. Scand J Immunol. 1998, 48: 15-25. 10.1046/j.1365-3083.1998.00343.x.View ArticlePubMed
  5. Boman HG: Antibacterial peptides: basic facts and emerging concepts. J Intern Med. 2003, 254: 197-215. 10.1046/j.1365-2796.2003.01228.x.View ArticlePubMed
  6. Lehrer RI, Ganz T: Antimicrobial peptides in mammalian and insect host defence. Curr Opin Immunol. 1999, 11: 23-27. 10.1016/S0952-7915(99)80005-3.View ArticlePubMed
  7. Yang D, Chertov O, Bykovskaia SN, Chen Q, Buffo MJ, Shogan J, Anderson M, Schröder JM, Wang JM, Howard OM, Oppenheim JJ: Beta-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science. 1999, 286: 525-528. 10.1126/science.286.5439.525.View ArticlePubMed
  8. Allaker RP: Host defence peptides-a bridge between the innate and adaptive immune responses. Trans R Soc Trop Med Hyg. 2008, 102 (1): 3-4. 10.1016/j.trstmh.2007.07.005.View ArticlePubMed
  9. Bevins CL, Jones DE, Dutra A, Schaffzin J, Muenke M: Human enteric defensin genes: chromosomal map position and a model for possible evolutionary relationships. Genomics. 1996, 31: 95-106. 10.1006/geno.1996.0014.View ArticlePubMed
  10. Schröder JM: Epithelial antimicrobial peptides: innate local host response elements. Cell Mol Life Sci. 1999, 56: 32-46. 10.1007/s000180050004.View ArticlePubMed
  11. Bauer F, Schweimer K, Klüver E, Conejo-Garcia JR, Forssmann WG, Rösch P, Adermann K, Sticht H: Structure determination of human and murine beta-defensins reveals structural conservation in the absence of significant sequence similarity. Protein Sci. 2001, 10: 2470-2479. 10.1110/ps.ps.24401.PubMed CentralView ArticlePubMed
  12. Semple CA, Maxwell A, Gautier P, Kilanowski FM, Eastwood H, Barran PE, Dorin JR: The complexity of selection at the major primate beta-defensin locus. BMC Evol Biol. 2005, 18 (5): 32-View Article
  13. Lehrer RI, Ganz T: Defensins of vertebrate animals. Curr Opin Immunol. 2002, 14: 96-102. 10.1016/S0952-7915(01)00303-X.View ArticlePubMed
  14. Patil AA, Cai Y, Sang Y, Blecha F, Zhang G: Cross-species analysis of the mammalian beta-defensin gene family: presence of syntenic gene clusters and preferential expression in the male reproductive tract. Physiol Genomics. 2005, 23: 5-17. 10.1152/physiolgenomics.00104.2005.View ArticlePubMed
  15. Kao CY, Chen Y, Zhao YH, Wu R: ORFeome-based search of airway epithelial cell-specific novel human beta-defensin genes. Am J Respir Cell Mol Biol. 2003, 29: 71-80. 10.1165/rcmb.2002-0205OC.View ArticlePubMed
  16. Rodríguez-Jiménez FJ, Krause A, Schulz S, Forssmann WG, Conejo-Garcia JR, Schreeb R, Motzkus D: Distribution of new human beta-defensin genes clustered on chromosome 20 in functionally different segments of epididymis. Genomics. 2003, 81: 175-183. 10.1016/S0888-7543(02)00034-4.View ArticlePubMed
  17. Schutte BC, Mitros JP, Bartlett JA, Walters JD, Jia HP, Welsh MJ, Casavant TL, McCray PB: Discovery of five conserved beta -defensin gene clusters using a computational search strategy. Proc Natl Acad Sci USA. 2002, 99: 2129-2133. 10.1073/pnas.042692699.PubMed CentralView ArticlePubMed
  18. Xiao Y, Hughes AL, Ando J, Matsuda Y, Cheng JF, Skinner-Noble D, Zhang G: A genome-wide screen identifies a single beta-defensin gene cluster in the chicken: implications for the origin and evolution of mammalian defensins. BMC Genomics. 2004, 5: 56-10.1186/1471-2164-5-56.PubMed CentralView ArticlePubMed
  19. Sang Y, Patil AA, Zhang G, Ross CR, Blecha F: Bioinformatic and expression analysis of novel porcine beta-defensins. Mamm Genome. 2006, 17: 332-339. 10.1007/s00335-005-0158-0.View ArticlePubMed
  20. Sang Y, Blecha F: Porcine host defense peptides: expanding repertoire and functions. Dev Comp Immunol. 2009, 33: 334-343. 10.1016/j.dci.2008.05.006.View ArticlePubMed
  21. Breathnach R, Chambon P: Organization and expression of eucaryotic split genes coding for proteins. Annu Rev Biochem. 1981, 50: 349-383. 10.1146/annurev.bi.50.070181.002025.View ArticlePubMed
  22. Archibald AL, Bolund L, Churcher C, Fredholm M, Groenen MA, Harlizius B, Lee KT, Milan D, Rogers J, Rothschild MF, Uenishi H, Wang J, Schook LB, Swine Genome Sequencing Consortium: Pig genome sequence--analysis and publication strategy. BMC Genomics. 2010, 11: 438-10.1186/1471-2164-11-438.PubMed CentralView ArticlePubMed
  23. Gonnet GH, Cohen MA, Benner SA: Exhaustive matching of the entire protein sequence database. Science. 1992, 256: 1443-1445. 10.1126/science.1604319.View ArticlePubMed
  24. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evol. 2011, 28: 2731-2739. 10.1093/molbev/msr121.PubMed CentralView ArticlePubMed
  25. Jones DT, Taylor WR, Thornton JM: The rapid generation of mutation data matrices from protein sequences. Comput Appl Biosci. 1992, 8: 275-282.PubMed
  26. Setcavage TM, Kim YB: Variability of the immunological state of germfree colostrum-deprived Minnesota miniature piglets. Infect Immun. 1976, 13: 600-607.PubMed CentralPubMed
  27. Thong LM, Choi H, Kwon OJ, Kim JH, Kim YB, Oh JW, Seo K, Yeom SC, Lee WJ, Park C: Systematic analysis of swine leukocyte antigen-DRB1 nucleotide polymorphisms using genomic DNA-based high-resolution genotyping and identification of new alleles. Tissue Antigens. 2011, 77: 572-583. 10.1111/j.1399-0039.2011.01662.x.View ArticlePubMed
  28. Semple CA, Rolfe M, Dorin JR: Duplication and selection in the evolution of primate beta-defensin genes. Genome Biol. 2003, 4: R31-10.1186/gb-2003-4-5-r31.PubMed CentralView ArticlePubMed
  29. Shi J, Zhang G, Wu H, Ross C, Blecha F, Ganz T: Porcine epithelial beta-defensin 1 is expressed in the dorsal tongue at antimicrobial concentrations. Infect Immun. 1999, 67: 3121-3127.PubMed CentralPubMed
  30. Veldhuizen EJ, Hendriks HG, Hogenkamp A, van Dijk A, Gaastra W, Tooten PC, Haagsman HP: Differential regulation of porcine beta-defensins 1 and 2 upon Salmonella infection in the intestinal epithelial cell line IPI-2I. Vet Immunol Immunopathol. 2006, 114: 94-102. 10.1016/j.vetimm.2006.07.012.View ArticlePubMed
  31. Veldhuizen EJ, van Dijk A, Tersteeg MH, Kalkhove SI, van der Meulen J, Niewold TA, Haagsman HP: Expression of beta-defensins pBD-1 and pBD-2 along the small intestinal tract of the pig: lack of upregulation in vivo upon Salmonella typhimurium infection. Mol Immunol. 2007, 44: 276-283. 10.1016/j.molimm.2006.03.005.View ArticlePubMed
  32. Veldhuizen EJ, Rijnders M, Claassen EA, van Dijk A, Haagsman HP: Porcine beta-defensin 2 displays broad antimicrobial activity against pathogenic intestinal bacteria. Mol Immunol. 2008, 45: 386-394. 10.1016/j.molimm.2007.06.001.View ArticlePubMed
  33. Veldhuizen EJ, Koomen I, Ultee T, van Dijk A, Haagsman HP: Salmonella serovar specific upregulation of porcine defensins 1 and 2 in a jejunal epithelial cell line. Vet Microbiol. 2009, 136: 69-75. 10.1016/j.vetmic.2008.09.072.View ArticlePubMed
  34. Elsik CG, Tellam RL, Worley KC, Gibbs RA, Muzny DM, Weinstock GM, Adelson DL, Eichler EE, Elnitski L, Guigó R, Hamernik DL, Kappes SM, Lewin HA, Lynn DJ, Nicholas FW, Reymond A, Rijnkels M, Skow LC, Zdobnov EM, Schook L, Womack J, Alioto T, Antonarakis SE, Astashyn A, Chapple CE, Chen HC, Chrast J, Câmara F, Ermolaeva O, Bovine Genome Sequencing and Analysis Consortium: The genome sequence of taurine cattle: a window to ruminant biology and evolution. Science. 2009, 324: 522-528.PubMed CentralView ArticlePubMed
  35. International Human Genome Sequencing Consortium: Finishing the euchromatic sequence of the human genome. Nature. 2004, 431: 931-945. 10.1038/nature03001.View Article
  36. Fjell CD, Jenssen H, Fries P, Aich P, Griebel P, Hilpert K, Hancock RE, Cherkasov A: Identification of novel host defense peptides and the absence of alpha-defensins in the bovine genome. Proteins. 2008, 73 (2): 420-430. 10.1002/prot.22059.View ArticlePubMed
  37. Zhao E, Xu H, Wang L, Kryczek I, Wu K, Hu Y, Wang G, Zou W: Bone marrow and the control of immunity. Cell Mol Immunol. 2012, 9 (1): 11-19. 10.1038/cmi.2011.47.PubMed CentralView ArticlePubMed
  38. Zhou CX, Zhang YL, Xiao L, Zheng M, Leung KM, Chan MY, Lo PS, Tsang LL, Wong HY, Ho LS, Chung YW, Chan HC: An epididymis-specific beta-defensin is important for the initiation of sperm maturation. Science. 2004, 286: 525-528.
  39. Yudin AI, Tollner TL, Li MW, Treece CA, Overstreet JW, Cherr GN: ESP13.2, a member of the beta-defensin family, is a macaque sperm surface-coating protein involved in the capacitation process. Biol Reprod. 2003, 69: 1118-1128. 10.1095/biolreprod.103.016105.View ArticlePubMed
  40. Narciandi F, Lloyd AT, Chapwanya A, O’ Farrelly C, Meade KG: Reproductive tissue-specific expression profiling and genetic variation across a 19 gene bovine β-defensin cluster. Immunogenetics. 2011, 63 (10): 641-651. 10.1007/s00251-011-0551-7.View ArticlePubMed
  41. Baroncelli S, Ricci E, Andreotti M, Guidotti G, Germano P, Marazzi MC, Vella S, Palombi L, De Rossi A, Giuliano M: Single-nucleotide polymorphisms in human b-defensin-1 gene in Mozambican HIV-1-infected women and correlation with virologic parameters. AIDS. 2008, 22: 1515-1517. 10.1097/QAD.0b013e3282fd6e0c.View ArticlePubMed
  42. Jurevic RJ, Bai M, Chadwick RB, White TC, Dale BA: Single-nucleotide polymorphisms (SNPs) in human beta-defensin 1: high-throughput SNP assays and association with Candida carriage in type I diabetics and nondiabetic controls. J Clin Microbiol. 2003, 41: 90-96. 10.1128/JCM.41.1.90-96.2003.PubMed CentralView ArticlePubMed
  43. Braida L, Boniotto M, Pontillo A, Tovo PA, Amoroso A, Crovella S: A single-nucleotide polymorphism in the human beta-defensin 1 gene is associated with HIV-1 infection in Italian children. AIDS. 2004, 18: 1598-1600. 10.1097/01.aids.0000131363.82951.fb.View ArticlePubMed
  44. Dale BA, Fredericks LP: Antimicrobial peptides in the oral environment: expression and function in health and disease. Curr Issues Mol Biol. 2005, 7: 119-133.PubMed CentralPubMed
  45. Kocsis AK, Lakatos PL, Somogyvári F, Fuszek P, Papp J, Fischer S, Szamosi T, Lakatos L, Kovacs A, Hofner P, Mándi Y: Association of beta-defensin 1 single nucleotide polymorphisms with Crohn’s disease. Scand J Gastroenterol. 2008, 43: 299-307. 10.1080/00365520701682615.View ArticlePubMed
  46. Selsted ME, Ouellette AJ: Mammalian defensins in the antimicrobial immune response. Nat Immunol. 2005, 6: 551-557. 10.1038/ni1206.View ArticlePubMed
  47. Cormican P, Meade KG, Cahalane S, Narciandi F, Chapwanya A, Lloyd AT, O’Farrelly C: Evolution, expression and effectiveness in a cluster of novel bovine beta-defensins. Immunogenetics. 2008, 60: 147-156. 10.1007/s00251-007-0269-8.View ArticlePubMed

Copyright

© 2012 Choi et al.; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.