Open Access

Screening of the arrestin gene in dogs afflicted with generalized progressive retinal atrophy

BMC Genetics20023:38

DOI: 10.1186/1471-2156-3-38

Received: 9 April 2002

Accepted: 17 July 2002

Published: 17 July 2002

Abstract

Background

Intronic DNA sequences of the canine arrestin (SAG ) gene was screened to identify potential disease causing mutations in dogs with generalized progressive retinal atrophy (gPRA). The intronic sequences flanking each of the 16 exons were obtained from clones of a canine genomic library.

Results

Using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and DNA sequence analyses we screened affected and unaffected dogs of 23 breeds with presumed autosomal recessively (ar) transmitted gPRA. In the coding region of the SAG gene 12 nucleotide exchanges were identified, 5 of which lead to amino acid substitutions (H14C; A111V; A113T; D259T; A379E). 7 other exonic substitutions represent silent polymorphisms (C132C; Q199Q; H225H; V247V; P264P; T288T and L293L). 16 additional sequence variations were observed in intronic regions of different dog breeds.

Conclusions

In several breeds, these polymorphisms were found in homozygous state in unaffected and in heterozygous state in affected animals. Consequently these informative substitutions provide evidence to exclude mutations in the SAG gene as causing retinal degeneration in 14 of the 23 dog breeds with presumed ar transmitted gPRA.

Background

gPRA is usually inherited as an ar blinding disorder with different ages of onset and variable rate of progression observed in more than 100 dog breeds. Typically, gPRA commences with degeneration of the rod photoreceptors. Initial signs include night blindness whereas progression involves the cones and the central vision [1, 2]. The human equivalent of canine gPRA is termed retinitis pigmentosa (RP). RP comprises a large and genetically heterogeneous group of blinding disorders. RP may be inherited in an ar, dominant, X-linked, digenic or maternal mode [37]. Similarly in dogs, at least 4 genes were identified so far as causing gPRA in 6 breeds. All of these genes encode photoreceptor specific proteins involved in the visual transduction cascade including the β-subunit of the cGMP-specific phosphodiesterase (PDE6B) in Irish Setters and Sloughis [8, 9] as well as the α-subunit of the cGMP-specific phosphodiesterase (PDE6A) in Cardigan Welsh Corgis [10]. A missense mutation was detected in the PDC gene that may be associated with photoreceptor dysplasia, a form of gPRA in the Miniature Schnauzer [11]. The X-linked form of PRA in Samoyed and Siberian Husky is caused by mutations in the RPGR gene [12]. Recently in English Mastiff dogs an autosomal dominantly transmitted form of gPRA was identified, mimicking human RP. The disease causing mutation is a T4R exchange in the rhodopsin (RHO ) gene [13]. A number of other retinal genes have been excluded as harbouring mutations for gPRA in several dog breeds: RHO; [14], RDS/peripherin and ROM -1 [15] as well as the α – and γ-subunits of transducin [16] and SAG [17]. Yet, the SAG gene had been analyzed on the exonic level exclusively, i.e. by sequencing of cDNA. The human SAG gene comprises 16 exons ranging in size between 243 and 10 bp. SAG protein (403 amino acids) has been identified only in retinal photoreceptor rods and pinealocytes [18].

SAG belongs to a family of inhibitory proteins that bind to tyrosine-phosphorylated receptors, thereby blocking their interaction with G-proteins and effectively terminating the signalling chain. In the phototransduction cascade, SAG and rhodopsin kinase (RHOK) act together in the recovery phase of RHO. After photoactivation, RHOK phosphorylates photoexited RHO which is then blocked by SAG binding thus inhibiting its ability to interact with transducin [19, 20]. The existence of stable complexes between RHO and its regulatory protein SAG were demonstrated to be responsible for retinal degeneration in several mutations in Drosophila [21]. Accumulation of these complexes triggers apoptotic cell death showing that retinal degeneration requires the endocytic machinery (op. cit. ). Interestingly, loss of function in the SAG gene causes ar inherited Oguchi disease in Japanese, a variant of congenital stationary night blindness [22, 23]. Apparently the mutation causing Oguchi disease can also lead to arRP in Japanese families [24]. Here we report on the identification of intronic sequences and mutation screening of the canine photoreceptor-specific SAG gene in 19 different dog breeds.

Results and Discussion

Genomic organization of the SAG gene

The screening of the canine genomic library with probes for exons 2, 5 and 16 led to the isolation of seven DNA clones, each containing different parts of the SAG gene. This gene contains 16 exons with the 5'UTR split into exons 1 (156 bp) and in 2 (57 bp). The 3'UTR is comprised in exon 16 (137 bp). The coding region is 1215 bp long. Most introns were longer than 1.5 kb (Table 2). Compared to the human SAG gene the position of intron 1, which is in the 5'UTR, is 23 bp further upstream in the dog. This means the canine exon 1 is 23 bp shorter and exon 2 23 bp longer than the equivalent human exons. In dogs exon 15 is 6 bp longer and exon 16 6 bp shorter than the equivalent exons in human. Therefore, the predicted protein in both species are 405 aa long and have a similarity of 89.8%. The intron sizes in man and dog differ, leading to gene sizes of ~ 35 kb in dog and ~ 40 kb in man. The splice donor and acceptor sites follow the GT/AG rule (Table 2). Canoidea-specific, tRNA-derived short interspersed nucleotide elements (SINE; [25]) were identified in introns 1, 3 and 14 and additional repetitive elements in introns 2, 3 and 14. The human SAG gene maps to chromosome 2q37.1. On the basis of reciprocal chromosome painting [26], the canine gene is, therefore, predicted to map to CFA 28 or 33, the homologous chromosomal regions in dogs.
Table 2

Primers for the characterization of the SAG gene

Exon

Forward primer,

reverse primer (5'–3')

Exon (#)

and size (bp)

Intron

size (bp)

splice donor site (gt ),

splice acceptor site (ag )

1–2

GGGCAACCCTGTCCAGG

(1) 156

836

 
 

ACACCCTGGGGTCTGTGTC

  

CACAAGgt acatg

2–3

AGTGAAAGAAGCTACCAGGGA

(2) 132

~ 5500

ttcccag CTTGCT

 

ACCCACAGGCTCTACTTGT

  

AAGTCGgt aagtgg

3–4

AGGTGACCATCTACTTGGG

(3) 61

~ 2600

cctatag GTGACC

 

AAAGTTCTTTCCTAGCACTAAGa

  

CTGTGGgt aagttg

4–5

AGATGGTATCGTGTTGGTGG

(4) 45

~ 1800

ggtttag ATGGTA

 

ACCGTGAGCAGGAAGGG

  

AGAAAGgt aagaca

5–6

AGTGTATGTCTCTCTGACCTG

(5) 194

~ 2000

cctccag TGTATGT

 

ACCTTCCCCATGTCTTGCG

  

CTCACGgt gggtg

6–7

CAAGTTTTACACACTGAGTGCa

(6) 60

~ 1300

cccacag TTCCCTG

 

TCGCAGGCCACAGAGGAGAAGa

  

GGGAAGgt tagtg

7–8

GTGCTGTGGGGTCGACTTT

(7) 77

~ 1500

actgcag TGCTGTG

 

CAGCACCCACAGCAGATTGa

  

CAAGAAgt aagagt

8–9

AGGAGGTCCGTGCGTTTTAC

(8) 136

905

tctgcag GAGCTCC

 

CTAATGCCTTTAATCTTCTTC

  

AAAGAGgt gagcca

9–10

CCTAGAAAGCCATGAGATTAAAa

(9) 85

~ 1500

ttttcag ATCTATT

 

AAGCCAAGCATCCTACTTCC

  

CATTAGgt aggaac

10–11

TGGAACAAGTGGCCAACGTTa

(10) 73

~ 2500

tctgcag TGGAACA

 

ACATGGTGCTGCAAGG

  

AACACAgt gagtag

11–12

GGACTGATGGTGGCTTTATGa

(11) 138

~ 3200

cctacag AGAAAAA

 

ACCCTGACACCGTGAGCTTC

  

CACCATgt gagtcc

12–13

TGAGGGATGTGTTCATCTAGa

(12) 78

1390

tgagcag AATAAAG

 

TTCATAACACCTCTGAGCTACa

  

GTCAGGgt gagtgt

13–14

CTGGAGGTGAGCTCTCCCA

(13) 24

~ 1400

ttcctag CTTTCTG

 

GTGCTCAGGGACCACTAG

  

CTCCAGgt aagcct

14–15

AGTGAAGTGGCAACTGAGGT

(14) 56

~ 3000

tttccag TGAAGTG

 

AAGCCGAAGACTGGGAGCa

  

ACCCAGgt cagtcg

15–16

CCTGCTCACGATTCTCTTTC

(15) 16

426

cttacag CTACGGC

 

GTCCAGGTCGACCGACCT

  

GGAAAGgt gagccc

  

(16) 237

 

tcttttag TTTTCA

PCR amplification of the canine SAG gene: primers for the identification of exon/intron boundaries and for the determination of intronic lengths of the canine genomic SAG clones (exon sequences are shown in upper case) athe intronic sequences of the SAG gene received the EMBL accessions numbers AJ426068-AJ426078

Mutation screening by PCR-SSCP analysis

The SAG gene was screened for mutations in 23 breeds, including all gPRA-affected, selected healthy dogs as well as obligatory carriers. The 16 exons were analysed by PCR-SSCP including all intronic splice signal sequences as well as the UTR s (i.e. complete cDNA plus >3070 bp of the introns). In the coding region of the SAG gene, 5 polymorphisms were identified that result in altered amino acid coding (H14C, A111V, A113T, D259T and A379E), and 7 silent polymorphisms were identified (C132C, Q199Q, H225H, V247V, P264P, T288T and L293L; Table 4). In addition, 13 sequence variations were identified in 9 introns of gPRA affected and unaffected animals (Table 4). Several gPRA-affected dogs in 14 of the 23 breeds were heterozygous for one of the aforementioned polymorphisms (Table 4). In 6 of these 14 dog breeds the major cause of gPRA has meanwhile been determined. Direct DNA tests are possible for Irish Setters and Sloughis [8, 9]. Indirect tests for progressive rod cone degeneration (prcd ) were recently offered for Australian cattle dogs, English Cocker Spaniels, Labrador Retrievers and Miniature poodles (patented by OptiGen, USA). These dog breeds were included as controls to characterise the identified polymorphisms to exclude linkage for causal gPRA mutations. A second gPRA form may be exist in Irish Setter because one affected Setter shows a late form of gPRA without the typical PDE6B mutation. Because of the clinical signs, also in Miniature poodles two types of gPRA are possible (OptiGen).
Table 4

SAG sequence variations and amino acid exchanges in respective dog breeds

   

Sequence variations in breed(s)a

Location

Sequence variation*

Amino acid exchange

In affected and gPRA unaffected dogs

gPRA affected dogs in heterozygous state

Intron 1

IVS1+393T→C

-

BDP, BS, GR, IRS, Rob, TT

BDP, GR,

Exon 2

UTR-5A→G

-

Bo, BS, GRc, BDP, IRS, SDc, Sl, TTb

Bo, GR, SD

 

c255A→G

H14C

SI

Sl

Exon 5

c526C→T

A111V

Sac

Sa

 

c531G→A

A113T

Sac

Sa

Intron 5

IVS5-30C→T

-

ECS, MP, Rob, Sac

ECS, MP, Sa

Exon 6

c610C→T

C132C

GR

GR

Intron 7

IVS7+10C→T

-

IRSb, GR, SPc

D, IRS, GR

 

IVS7+52Ins.G

-

GRc

GR

 

IVS7-4Del.G

-

CCRb D, GR, IRS, MP, SDc, Slc, SPb, TTc

D, GR, IRS, SD

Exon 8

c811G→A

Q199Q

GR

GR

Intron 8

IVS8+8A→G

-

D, ECSc, GRc, LRc, Sa

D, ECS, GR, Sa

Exon 9

c874T→C

H225H

Bo, BDP, CCRb, ECS, D, GRc, IRS, MP, NF, Rob, Sa, Slb, TTbc

Bo, ECS, D, GR, IRS, MP, NF, Sa

Exon 10

c949G→T

V247V

IRS, GR

GR

 

c983G→T

D259T

ACb

AC

 

c1000A→G

P264P

AC, LR, IRSb, GR

GR

Intron 10

IVS10-18G→C

-

GR, IRS, BDP

GR

 

IVS10-33C→T

-

GR, IRS

GR

Exon 11

c1063G→A

T288T

BS, BDP, GR, IRSb, Sa

BS, GR, Sa

 

c1076C→T

L293L

BS, BDP, GRc, Sa, TT

BS, Sa

Intron 11

IVS11-51Ins.TT

-

Sa, IRSb

Sa

Intron 13

IVS13+66C→G

-

Sa, IRSb

Sa

Intron 14

IVS14-45Del.A

-

PON

PON

Intron 15

IVS15+14C→T

-

Sa

-

 

IVS15+86T→A

-

Sa

-

 

IVS15-45Ins.C

-

PON, AWbc, SPb

PON

Exon 16

c1344C→A

A379E

IRSb, ECSb, GRc, PON, Sabc, TTb

ECS, GR

a For abbreviations see Table 1 b Homozygous state in gPRA affected dogs c Homozygous state in unaffected dogs *(EMBL accession number for cDNA: X98460; EMBL accession numbers for genomic DNA: AJ426068-AJ426078)

Conclusions

None of the amino acid changes identified here in dogs correspond to residues that are mutated in known RP, nor are they known to be important for binding activated dephosphorylated RHO [22, 23, 27]. As detailed above, Oguchi disease and some forms of arRP is caused by the deletion in codon 309 in Japanese. None of the aa exchanges in the dog breeds investigated here correspond with this region. Nevertheless, these novel sequence variations can be used as intragenic markers for segregation analyses with ar gPRA. The breeding history, small population sizes and gPRA abundance in the investigated breeds point together to few meiotic events in which intragenic recombinations could have occured between an unidentified mutation in the SAG locus in gPRA dogs and the polymorphisms investigated here. Given ar transmission our typing results suggest that the sequence variations in the SAG gene are not causative for gPRA in the following 14 dog breeds: AC, BDP, Bo, BS, ECS, D, IRS, GR, MP, NF, PON, Sa, SD and Sl. In 6 of these dog breeds only one gPRA affected animal was available for mutation analysis (Table 1). For these breeds the exclusion of theSAG gene is not definitive, since the possibility of false diagnosis is not ruled out completely. Nevertheless, gPRA-affected AW, CCR, SP, LR, Ro and TT show homozygous sequence variation patterns and 3 dog breeds (Co, EM, GS) did not harbour any sequence variations. Therefore, the SAG gene cannot be excluded as a cause for gPRA in these breeds, especially because of mutations in the elusive regulatory regions for gene expression.
Table 1

Characteristics of dog breeds examined

Breed (abbreviation)

Number of dogs

Diagnosis

Onset forms of gPRA

Age distribution (year)f

Afghan Hound (AW)

1

gPRA-affected

lateb

6

 

4

normal

 

2–12

Australian Cattle dogs (AC)

2

gPRA-affected

latea

10

 

19

normal

 

2–4

Berger des Pyrénées (BDP)

1

gPRA-affected

mid-onsetb

5

 

42

normal

 

1–10

Berner Sennenhund (BS)

1

gPRA-affected

lateb

10

Bolognese (Bo)

1

gPRA-affected

lateb

9

Collie (Co)

3

gPRA-affected

earlycd

4–8

 

1

normal

 

8

Curly Coated Retriever (CCR)

1

gPRA-affected

lateb

6

Dachshund (wire; D)

20

gPRA-affected

variableb

1–13

 

49

normal

 

6–13

Engl. Cocker Spaniel (ECS)

6

gPRA-affected

latecd

3–11

 

6

normal

 

6–14

English Springer Spaniel (SP)

1

gPRA-affected

 

7

Entlebucher Mountain Dog (EM)

17

gPRA-affected

latee

5–13

 

10

normal

 

1–7

Giant Schnauzer (GS)

1

gPRA-affected

lateb

10

Golden Retriever (GR)

2

gPRA-affected

lateb

5–10

 

8

normal

 

3–6

Irish Setter (IRS)

2

gPRA-affected

earlycd/lateb

0.6–7

 

1

normal

 

3–13

Labrador Retriever (LR)

5

gPRA-affected

latecd

8–12

 

140

normal

 

3–13

Miniature poodle (MP)

28

gPRA-affected

latecd

5–12

 

15

normal

 

1–12

Newfoundland Dog (NF)

1

gPRA-affected

mid-onsetb

3

Polski Owczarek Nizinny (PON)

1

gPRA-affected

lateb

9

Rottweiler (Ro)

1

gPRA-affected

lateb

3

Saarloos/Wolfhond (Sa)

7

gPRA-affected

lateb

7–9

 

118

normal

 

2–10

Schapendoes (SD)

3

gPRA-affected

earlyd

2–6

 

7

normal

 

3–6

Sloughi (Sl)

5

gPRA-affected

mid-onsetb

2

 

183

normal

 

0.1–12

Tibetan Terrier (TT)

3

gPRA-affected

mid-onsetcd

7–8

 

93

normal

 

2–10

a[34]. b owners report/certificate of eye examination. c classifications of the different onset forms of gPRA in the reviews [1] and [2]. d online information among PRA Today http://www.sheepdog.com/diseases/pra/clinical. e[35]. f at the time when blood was taken for DNA analysis.

Materials and Methods

Animals

Blood from 810 dogs of 23 different breeds, including 113 gPRA-affected animals (Table 1) was collected with the permission of the owners and in cooperation with breeding organisations. Experienced veterinarians confirmed the gPRA status of healthy and affected dogs by ophthalmoscopy.

Isolation of canine DNA and PCR

DNA was extracted from peripheral blood according to standard protocols [28]. Portions of the SAG gene were amplified by PCR in a thermocycler (Biometra, Goettingen, Germany) from the inserts of the λ phages in order to obtain intronic sequences. Genomic DNAs from all gPRA-affected, obligate carrier and gPRA-unaffected dogs were screened for sequence variations. PCRs were performed in 96-well microtiter plates (Thermowell Costar Corning, NY). Each well contained 50 ng DNA in 10 μl reaction volume (100 mM Tris [pH 8.3], 500 mM KCl, 1 U Taq Polymerase [Genecraft, Münster, Germany], 0.2 mmol of each NTP, 0.4 mM of each primer and varying concentrations of MgCl2 [Table 3]). For SSCP analysis, 0.06 μl of [α32P] dCTP (10 mCi/ml) was included in the PCR. Parts of the λ phage inserts were amplified in a one step PCR (annealing temperatures in Table 3). For genomic mutation analysis PCR conditions included initial denaturation (5 min at 95°C), the 10 initial cycles 1°C above the annealing temperature (Table 3), 22–25 cycles of 95°C (30 s), annealing temperature (30 s), elongation at 72°C (40 s) and a final elongation step at 72°C (3 min).
Table 3

Primer sequences used for mutation analysis of individual exons/introns of the canine SAG gene

Primer

Location

Forward primer, reverse primer (5'–3')a

PCR conditions [T-°C/MgCl2-mM]

PCR amplicon length (bp)

Restriction enzymes for SSCP analyses

UTR1F

exon 1

GGGCAACCCTGTCCAGGT

54/1.0

699

Nla III/Rsa I

UTRI-1aR

intron 1

TCTATCATGACGGGACGCCT

   

UTRI-1aF

intron 1

GAAAATGATATTTGCAAAGCAG

50/1.0b

283

Tru 1I

UTRI-1aR

intron 1

TCTATCATGACGGGACGCCT

   

1-IF

intron 1

CTAATGGGCACACAGCATCTC

53/1.0

249

Pvu III; Nla IIIc

2-I2R

intron 2

TTCTGTTAAGCCACTCACTTC

   

3-IF

intron 2

TGTTTTTATCTAACACTGACTACTTC

48/1.0b

224

Nla III

3-IR

intron 3

AAATAACAAAGTAGCAGCTGTC

   

4-IF

intron 3

AACTGCAGATAAATATATGAAG

52/1.0

189

Alu I

4-IR

intron 4

AAAGTTCTTTCCTAGCACTAAG

   

5-IF

intron 4

GGTTACCCCATGTTCACTTG

56/1.0

343

Mnl I

5-IR

intron 5

GCTCCTGGTCACACTGCAAG

   

6-IF

intron 5

CAAGTTTTACACACTGAGTGC

55/1.0

213

Alu I

6-IR

intron 6

ATTTTCCCCAGAGAAAAGGCTA

   

7-IF

intron 6

CGGGAAGGGAGGTGCTGA

58/1.0

233

Rsa Ic

7-IR

intron 7

TCGCAGGCCACAGAGGAGAAG

   

8-IF

intron 7

ATCACAGCGTGAGTACGGGGAG

55/1.0

288

RsaI; Pst Ic

8-IR

intron 8

CAGCACCCACAGCAGATTG

   

9-IF

intron 8

CCTAGAAAGCCATGAGATTAA

55/1.5

214

Tru I1; Sty Ic

9-IR

intron 9

GACCAGACTGAGAAATTCTAG

   

10-IF

intron 9

GGCACCATGCACATGCGTG

58/1.0

235

Alu I

10-IR

intron 10

AAGCCAAGCATCCTACTTCC

   

11-IF

intron 10

GGACTGATGGTGGCTTTATG

58/1.0

266

BsuR I

11-IR

intron 11

AGCAGACCAGCACCTCCTC

   

12-IF

intron 11

TGAGGGATGTGTTCATCTAG

55/1.0

183

-

12-IR

intron 12

GCCCATGGTGTTGGCTCTTG

   

13-IF

intron 12

CATGCTTGGGACATGTCCAC

64/1.0

209

Mva I

13-IR

intron 13

TTCATAACACCTCTGAGCTAC

   

14-IF

intron 13

CTCTGCAGCCACAGCCCTTC

50/2.0

229

Ava II

14-IR

intron 14

GTGCTCAGGGACCACTAG

   

15-IF

intron 14

CCTGCTCACGATTCTCTTTC

58/1.0

244

Hph I

15-IR

intron 15

AAGCCGAAGACTGGGAGC

   

16-IF

intron 15

GATCGGTCCCTTGTTGCA

52/2.0b

347

Alu I

16-ER

Exon 16

CACAGCTGAACAGACAAACTT

   

aSee EMBL accession numbers AJ426068-AJ426078 bwith 5% formamide cwith RLFP analysis

Cloning and identification of exon/intron junctions

Clones containing the SAG gene were isolated from a genomic canine λ-DNA library (λ FIX®II Library; host: E. coli XL1-Blu MRA (P2) Stratagene, La Jolla, Ca, USA) according the manufacturer's protocol. Recombinant λ DNA was fixed to Hybond™-N Nylon membranes (Amersham, Buckinghamshire, UK) and UV-crosslinked (1' 70 J/cm2). The library was screened with probes prepared from PCR products corresponding to portions of exons 2, 5 and 16 (nucleotides 909–1157 of EMBL accession number CFA426068, nucleotides 395–588, and 1333–1579 of EMBL accession number X98460, respectively). These probes were labelled using [α32P] dATP and the Megaprime Labelling System (Amersham, Buckinghamshire, UK). Hybridisations were performed at 65°C in 0.5 M sodium phosphate buffer (pH 7.2)/7% sodium dodecyl sulfate [29]. After hybridisation the filters were washed twice for 30 min each in 2× SSC/1% SDS, once for 15 min with 0.2× SSC/1%SDS at 65°C and for 30 min with 6×SSC at room temperature. The filters were exposed to phosphoimager screens (STORM 860) and evaluated with the programs STORM Scanner Control and Image Quant (Molecular Dynamics). Hybridising clones were isolated and plaque purified as described [30]. The approximate insert sizes of the different clones were estimated with exon primers via PCR (see conditions described above using~0.2 ng phage DNA, 2 mM MgCl2 and annealing temperature of 54°C in the PCR).

Exon/intron boundaries were analysed by comparison of canine mRNA ([17], EMBL accession number X98460) with 16 genomic sequences of the human SAG gene (5'-flanking region and exon 1 [18]; EMBL accession number X12453); exons 2–16 ([31]; EMBL accession numbers U70963-U70976) using the program Blast Search (NCBI http://www.ncbi.nlm.nih.gov/blast). Intronic sizes were estimated by overlapping PCR including parts of neighbouring exons. PCR products were extracted from 1.5% agarose gels using the Easy Pure extraction kit (Biozym, Germany) and sequenced with intron-overlapping primers (Table 2). Sequencing reactions from 2–3 clones were carried out by the dideoxy-chain termination method using the BDT (Perkin-Elmer, Norwalk, CT) according to the manufacturer's instructions. All sequencing reactions were run on an automated DNA sequencer (Applied Biosystems 373 XL, Foster City, USA) and analysed using ABI Prism™ 373XL.

PCR-SSCP and DNA sequence analysis

Positions of intronic primers which were used for mutation screening were selected after DNA sequence analysis of the genomic SAG clones (Table 3). SSCP samples were treated as previously described [16, 32]. PCR products were digested dependent on the lengths of the fragments [33] with different restriction enzymes (Table 3). Using restriction length fragment polymorphism (RLFP) analysis the sequence variants in exon 2 (Nla III), intron 7 (Rsa I), exon 8 (Pst I) and exon 9 (Sty I) were investigated. 3 μl of the PCRs were denatured with 7 μl of loading buffer (95% deionised formamide 10 mM NaOH, 20 mM EDTA, 0.06% (w/v) xylene cyanol, and 0.06% (w/v) bromophenol blue). The samples were heated to 95°C for 5 min and snap cooled on ice. 3 μl aliquots of the single-stranded fragments were separated in 2 sets of 6% polyacrylamide (acrylamide/bisacrylamide: 19/1) gels, one set containing 10% glycerol, another containing 5% glycerol and 1 M urea. Gels were run with 1× TBE buffer at 50–55 W for 4–6 h at 4°C. All gels were dried and subjected to autoradiography over night. Selected DNA samples with band shifts evidenced by SSCP electrophoresis were purified and cycle sequenced as described above.

Declarations

Acknowledgements

We thank Jana Held for work in the laboratory, the owners of the dogs for blood samples, the veterinarians of the Dortmunder Ophthalmologenkreis (DOK) for the ophthalmologic investigations of the dogs and the different breeding clubs for support. These studies were supported in part by the Gesellschaft für kynologische Forschung, Bonn (Germany).

Authors’ Affiliations

(1)
Molecular Human Genetics, Ruhr-University

References

  1. Clements PJM, Sargan DR, Gould SM, Petersen–Jones SM: Recent advances in understanding the spectrum of canine generalised progressive retinal atrophy. J Small Anim Pract 1996, 37: 155–62.View ArticlePubMedGoogle Scholar
  2. Petersen–Jones SM: A Review of research to elucidate the cause of the generalized progressive retinal atrophies. Vet J 1998, 155: 5–18.View ArticlePubMedGoogle Scholar
  3. Farrar GJ, Jordan SA, Kumar–Singh R, Inglehearn CF, Gal A, Greggory C: Extensive genetic heterogenety in autosomal dominant retinitis pigmentosa. In: Retinal degeneration (Edited by: Hollyfield JG, Anderson RE, LaVail MM). New York Plenum Press 1993, 63–77.Google Scholar
  4. Kajiwara K, Berson EL, Dryja TP: Digenic retinitis pigmentosa due to mutations at the unlinked peripherin/RDS and ROM1 loci. Science 1994, 264: 1604–1607.View ArticlePubMedGoogle Scholar
  5. Dryja TP, Li T: Molecular genetics of retinitis pigmentosa. Hum Mol Genet 1995, 4: 1739–1743.PubMedGoogle Scholar
  6. Shastry BS: Signal transduction in the retina and inherited retinopathies. Cell Mol Lif Sci 1997, 53: 419–429.View ArticleGoogle Scholar
  7. Manserg FC, Millington–Ward S, Kennan A, Kiang AS, Humphries M, Farrar GJ, Humphries P, Kenna PF: Retinitis pigmentosa and progressive sensorineural hearing loss caused by a C12258A mutation in the mitochondrial MTTS2 gene. Am J Hum Genet 1999, 64: 971–985.View ArticleGoogle Scholar
  8. Suber ML, Pittler SJ, Qin N, Wleft GC, Holcombe V, Lee RH, Craft CM, Lolley RN, Baehr W: Irish setter dogs affected with rod/cone dysplasia contain a nonsense mutation in the rod cGMP Phosphodiesterase beta–subunit gene. Proc Natl Acad Sci USA 1993, 90: 3968–3972.View ArticlePubMedGoogle Scholar
  9. Dekomien G, Runte M, Gödde R, Epplen JT: Generalised progressive retinal atrophy of Sloughi dogs is due to an 8–bp insertion in exon 21 of the PDE6B gene. Cytogenet Cell Genet 2000, 90: 261–267.View ArticlePubMedGoogle Scholar
  10. Petersen–Jones SM, Entz DD, Sargan DR: cGMP phosphodiesterase–α mutation causes progressive retinal atrophy in the cardigan welsh corgi dog. Invest Ophthalmol Vis Sci 1999, 40: 1637–1644.PubMedGoogle Scholar
  11. Zhang Q, Acland GM, Parshall CJ, Haskell J, Ray K, Aguirre GD: Characterization of canine photoreceptor Phosducin cDNA and identification of a sequence variant in dogs with photoreceptor dysplasia. Exp Eye Res 1998, 67: 473–480.View ArticleGoogle Scholar
  12. Aguirre G: Genes and diseases in man and models. Prog Brain Res 2001, 131: 663–678.View ArticlePubMedGoogle Scholar
  13. Kijas JW, Cideciyan AV, Aleman TS, Pianta MJ, Pearce–Kelling SE, Miller BJ, Jacobson SG, Aguirre GD, Acland GM: Naturally occurring rhodopsin mutation in the dog causes retinal dysfunction and degeneration mimicking human dominant retinitis pigmentosa. Proc Natl Acad Sci 2002, 99: 6328–33.View ArticlePubMedGoogle Scholar
  14. Gould DJ, Petersen–Jones SM, Sohal A, Barnett KC, Sargan DR: Investigation of the role of opsin gene polymorphism in generalized progressive retinal atrophies in dogs. Anim Genet 1995, 26: 261–267.PubMedGoogle Scholar
  15. Runte M, Dekomien G, Epplen JT: Evaluation of RDS/Peripherin and ROM1 as candidate genes in generalised progressive retinal atrophy and exclusion of digenic inheritance. Anim Genet 2000, 31: 223–227.View ArticlePubMedGoogle Scholar
  16. Dekomien G, Klein W, Epplen JT: Polymorphisms in the canine rod transducin gene and exclusion as cause for generalised progressive retinal atrophy (gPRA). J. Exp. Anim. Sci. 1998, 39: 86–90.Google Scholar
  17. Veske A, Narfstrom K, Finckh U, Sargan DR, Nilsson SE, Gal A: Isolation of canine retinal arrestin cDNA and exclusion of three candidate genes for Swedish Briard retinal dystrophy. Curr Eye Res 1997, 16: 270–274.View ArticlePubMedGoogle Scholar
  18. Yamaki K, Tsuda M, Kikuchi T, Chen KH, Huang KP, Shinohara T: Structural organization of the human S–antigen gene: cDNA, amino acid, intron, exon, promoter, in vitro transcription, retina, and pineal gland. J Biol Chem 1990, 265: 20757–20762.PubMedGoogle Scholar
  19. Wilson CJ, Applebury ML: Arresting G–protein coupled receptor activity. Curr. Biol 1993, 3: 683–686.View ArticlePubMedGoogle Scholar
  20. Hofmann KP, Jäger S, Ernst OP: Structure and function of activated rhodopsin. Isr J Chem 1995, 35: 339–355.Google Scholar
  21. Alloway PG, Howard L, Dolph PJ: The formation of stable rhodopsin–arrestin complexes induces apoptosis and photoreceptor cell degeneration. Neuro 2000, 28: 129–138.View ArticleGoogle Scholar
  22. Fuchs S, Nakazawa M, Maw M, Tamai M, Oguchi Y, Gal A: A homozygous 1–base pair deletion in the arrestin gene is a frequent cause of Oguchi disease in Japanese. Nat Genet 1995, 10: 360–362.View ArticlePubMedGoogle Scholar
  23. Sippel KC, DeStefano JD, Berson EL, Dryja TP: Evaluation of the human arrestin gene in patients with retinitis pigmentosa and stationary night blindness. Invest Ophthalmol Vis Sci 1998, 39: 665–670.PubMedGoogle Scholar
  24. Nakazawa M, Wada Y, Tamai M: Arrestin gene mutations in autosomal recessive retinitis pigmentosa. Arch Ophthalmol 1998, 116: 498–501.PubMedGoogle Scholar
  25. Bentolila S, Bach JM, Kessler Jl, Bordelais C, Weissenbach J, Panthier J: Analysis of major repetitive DNA sequences in the dog (canis familiaris) genome. Mamm Genome 1999, 10: 699–705.View ArticlePubMedGoogle Scholar
  26. Yang F, O'Brien PC, Milne BS, Graphodatsky AS, Solanky N, Trifonov V, Rens W, Sargan D, Ferguson–Smith MA: A complete comparative chromosome map for the dog, red fox, and human and its integration with canine genetic maps. Genomics 1999, 62: 189–202.View ArticlePubMedGoogle Scholar
  27. Vishnivetskiy SA, Paz CL, Schubert C, Hirsch JA, Sigler PB, Gurevich VV: How does arrestin respond to the phosphorylated state of rhodopsin? J Biol Chem 1999, 274: 11451–11454.View ArticlePubMedGoogle Scholar
  28. Miller SA, Dykes DD, Polesky HF: A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988, 16: 1215.View ArticlePubMedGoogle Scholar
  29. Church GM, Gilbert W: Genomic sequencing. Proc Natl Acad Sci USA 1984, 81: 1991–1995.View ArticlePubMedGoogle Scholar
  30. Sambrook J, Fritsch EF, Maniatis : Molecular cloning: A laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press 1989.
  31. Yamamoto S, Sippel KC, Berson EL, Dryja TP: Defects in the rhodopsin kinase gene in the Oguchi form of stationary night blindness. Nat Genet 1997, 15: 175–178.View ArticlePubMedGoogle Scholar
  32. Dekomien G, Epplen JT: Exclusion of the PDE6A gene for generalised progressive retinal atrophy in 11 breeds of dogs. Anim Genet 2000, 31: 135–139.View ArticlePubMedGoogle Scholar
  33. Jäckel S, Epplen JT, Kauth M, Miterski B, Tschentscher F, Epplen C: PCR–SSCP or how to detect reliably and efficiently each sequence variation in many samples and many genes. Electrophoresis 1998, 19: 3055–3061.View ArticleGoogle Scholar
  34. Laratta LJ, Sims MH, Brooks DE: Progressive retinal degeneration in the Australian cattle dog. Proc Am Coll Vet Ophthal 1988, 19: 9.Google Scholar
  35. Spiess BM: Inherited ocular diseases in the Entlebucher Mountain Dog. Schweiz Arch Tierheilk 1994, 136: 105–110.Google Scholar

Copyright

© Dekomien and Epplen. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL. 2002