Open Access

A microsatellite linkage map of Drosophila mojavensis

BMC Genetics20045:12

DOI: 10.1186/1471-2156-5-12

Received: 12 March 2004

Accepted: 26 May 2004

Published: 26 May 2004

Abstract

Background

Drosophila mojavensis has been a model system for genetic studies of ecological adaptation and speciation. However, despite its use for over half a century, no linkage map has been produced for this species or its close relatives.

Results

We have developed and mapped 90 microsatellites in D. mojavensis, and we present a detailed recombinational linkage map of 34 of these microsatellites. A slight excess of repetitive sequence was observed on the X-chromosome relative to the autosomes, and the linkage groups have a greater recombinational length than the homologous D. melanogaster chromosome arms. We also confirmed the conservation of Muller's elements in 23 sequences between D. melanogaster and D. mojavensis.

Conclusions

The microsatellite primer sequences and localizations are presented here and made available to the public. This map will facilitate future quantitative trait locus mapping studies of phenotypes involved in adaptation or reproductive isolation using this species.

Background

Evolutionary biologists have struggled to determine the number and types of genetic changes that lead to speciation. Recent advances in molecular techniques facilitate a more thorough investigation into these issues. For example, by mapping quantitative trait loci (QTLs) affecting interesting traits, we can explore the genetic basis of phenotypic variation between two populations that may lead to reproductive isolation.

One hallmark species used in studies of speciation and ecological adaptation is the desert cactophilic Drosophila mojavensis. D. mojavensis belongs to the mulleri complex of the repleta species group within the subgenus Drosophila. Unlike many well-studied Drosophila, its ecological niche has been well documented, and extensive cytogenetic work has been done on it and its close relative, D. arizonae [see e.g., [1]]. With regard to speciation, D. mojavensis has been the subject of many genetic and phenotypic studies of mate choice [e.g., [25]], hybrid sterility and inviability [6, 7], and variation in sperm and female sperm-storage organ length [8, 9]. However, all of these studies have been forced to use a handful of either allozyme or morphological mutant markers. Microsatellites have been isolated from this species before [10], but they are unmapped and their sequences are not available.

Here, we present a microsatellite-based linkage map of the five major chromosomes of D. mojavensis using a new set of markers. We mapped 25 microsatellites to the X chromosome and 65 microsatellites spanning the four major autosomes. We also use our results to confirm the conservation of Muller's chromosome elements [11] across approximately 65 million years of evolutionary divergence between D. melanogaster and D. mojavensis [see [12]]. Muller [11] had suggested that chromosomal elements conserve their identities (ie, complement of genes) across all Drosophila species, and several subsequent studies have supported this idea [e.g., [1315]], though only one study involving the repleta group [16].

Results and Discussion

Primers were successfully developed for a total of 116 markers. Of these, 26 did not distinguish between the two isofemale lines that were used for mapping and were therefore not pursued. We mapped 25 microsatellites onto the X-chromosome, 10 onto chromosome 2, 7 onto chromosome 3, 13 onto chromosome 4, and 10 onto chromosome 5. Twenty-five more microsatellites were confirmed to be autosomal but could not be mapped because of segregating polymorphism within our lines. Microsatellites were named based on their localizations, where the fifth character of the name was an X if X-linked, A if unmapped autosomal, or a number indicating a specific autosome. The distribution of microsatellites across the chromosomes suggests a possible excess of repetitive sequences on the X-chromosome (27.8% observed vs. 20% expected assuming all chromosomes are similar in size, chi-square test, p = 0.07; 27.8% observed vs. 18.7% expected assuming chromosomes are the same size as D. melanogaster homologous chromosome arms, chi-square test, p = 0.03).

Using two female-parent backcrosses, we constructed a recombinational map of the Drosophila mojavensis genome using 34 of our microsatellites: 13 on the X-chromosome, 7 on chromosome 2, 4 on chromosome 3, 7 on chromosome 4, and 3 on chromosome 5. Recombinational distances are presented in Figure 1. DMOJX040 was not placed in the figure because it was only 0.7 cM from DMOJX030. The recombinational lengths of the chromosomes generally exceed the homologous chromosome arms in D. melanogaster and some other Drosophila species. For example, the X-chromosome in D. mojavensis spanned 130.8 cM, while the X-chromosome in D. melanogaster spans only 73 cM. Even within the repleta species group, D. buzzatii has an X-chromosome that spans 109 cM [17] and D. hydei's X spans 116 cM [12]. Similarly, D. mojavensis chromosome 2 could only be assembled into three pieces that recombine freely from each other. This difference between species in recombinational length most likely indicates an overall greater recombination rate per megabase in D. mojavensis, but we cannot exclude dramatic differences in sequence lengths of the chromosome arms.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2156-5-12/MediaObjects/12863_2004_Article_184_Fig1_HTML.jpg
Figure 1

Linkage map of the five major chromosomes of Drosophila mojavensis. From left to right, are the X-chromosome, chromosome 2, chromosome 3, chromosome 4, and chromosome 5. Kosambi recombinational distances between markers are on the left of each chromosome, and the microsatellite names are on the right. A question mark appears between markers or groups when markers were assigned to the same chromosomes but freely recombined from each other.

We recombinationally mapped some markers in a second cross because of segregating variation within the lines. Figure 1 presents the most conservative map, where all markers were mapped against each other for any particular chromosome. However, we have some additional information about the linkage of other microsatellites. Specifically, we observed that DMOJ4200 is freely recombining from all the 4-chromosome markers between and including DMOJ4010 and DMOJ4060. Also, the following markers are freely recombining from each other on chromosome 5: DMOJ5100, DMOJ5200, DMOJ5300, and DMOJ5400.

To evaluate the conservation of Muller's elements across 65 million years, we used BLAST [18] to identify segments homologous to the sequences flanking the 65 microsatellites in D. mojavensis that were mapped to chromosome. We identified segments mapped to D. melanogaster chromosomes similar to 23 of the sequences isolated from D. mojavensis (see Table 1). The inferred homology of the arms are as follows (melanogaster:mojavensis): X:X, 2L:3, 2R:5, 3L:4, 3R:2 [19, 20]. Based on the BLAST results, all 23 D. mojavensis sequences matched D. melanogaster sequences on the homologous chromosome arms. This observation strongly supports the conservation of Muller's elements between the subgenera Drosophila (D. mojavensis) and Sophophora (D. melanogaster).
Table 1

Ninety microsatellites mapped in Drosophila mojavensis. Microsatellites assigned to chromosome "A" were autosomal but could not be mapped to a particular autosome because of variation segregating within the lines used for mapping. We present the BLAST expect (E) value in the column after the microsatellite name only for the 23 microsatellites used in the Muller's chromosome element comparison.

Name

BLAST E-value

Chromosome

Size

Primers

Repeat motif

GenBank Accession

DMOJX010

 

X

132

attgtgttgcgccttagggc

gtgataatttgttgatttgggtgcatgtc

(ca)11

AY578823

DMOJX020

 

X

142

ctctgccactcaacggacc

ctcttcagtgttgcctagggtatac

(ca)7

AY578824

DMOJX030

 

X

124

aagctatgcctagttgtcacttcc

caaacggcatttcatataagaatctatctcac

(ag)9

AY578825

DMOJX040

 

X

147

aggcatgccttagtttgtgtcac

cacacatattaagcattgtattacaatcgtccc

(ac)15

AY578826

DMOJX050

 

X

143

accaagcaaaagccaattgcac

caaagctttgccggcattagc

(ac)12

AY578827

DMOJX060

 

X

128

caattgtggagttgcgtttgcac

cacgcatttctgattgaccatacac

(ac)12

AY578828

DMOJX070

1e-19

X

163

gccactcgttgttgtcccta

atagttctttgctctatatgcgtgtg

(ca)4

AY578829

DMOJX080

 

X

202

ccactccacgttcgcttgac

cacaatgtagagctccctttaatctcc

(ac)14

AY578830

DMOJX090

 

X

149

ccttcaactttgtcgctccagac

caatcaaagcgaacgtagctcaatg

(ca)9

AY578831

DMOJX100

 

X

160

tttgtatataaggcggaaaggcgg

gtctgtatataatttaataagttgttacgtaaaagaactcac

(gt)20

AY578832

DMOJX110

2e-09

X

98

cagtggcgctcaaaaggtctg

gggatgtatggggtctatgggtg

(ca)9

AY578833

DMOJX120

 

X

110

gcctgcatttgtgcatctgc

caagtgtttgccaaagctgcag

(tg)13

AY578834

DMOJX130

 

X

130

tgggctacacttcagcaaacattc

tcatgtgcaaaggtagccaagc

(ca)11

AY578835

DMOJX500

 

X

100

caattattgcatagccacgccc

cgagcacttttccaatttttggc

(gt)11

AY578836

DMOJX501

 

X

136

ctcgagcgaattttcctattggatttc

ccaacgagccatttcctcacg

(ca)6

AY578837

DMOJX502

 

X

107

attaaagtgcattaaatgacacagccac

ctctgccttcacgtgtgc

(ca)10

AY578838

DMOJX503

 

X

136

gcgaagaattgcaaatacccttgtag

aagcaaatatacacaacatacacatgtgc

(gt)10

AY578839

DMOJX504

 

X

126

catcaatctctagaatgcctcacgc

gagtgactcactttaaagcgagctc

(gt)8

AY578840

DMOJX505

0.004

X

128

tcgcttgtttccgtttagtaaccg

tacgcgtatgcgtatgcatgc

(ac)10

AY578841

DMOJX506

2e-15

X

149

actgcctacactgctctgtctc

acaggctttacacatggccaaataac

(tc)16

AY578842

DMOJX507

 

X

166

ttttctttgcatcggcttagttgc

cacatatggaaatgcagcacgaac

(tc)15

AY578843

DMOJX508

4e-43

X

248

aagcagcctagctgaacagttg

cattgggaagagctgatgtatagacg

(ac)12

AY578844

DMOJX509

 

X

157

agctgattaacgaagcagatttcgtg

ttccattcatgaaccactcacacatc

(ga)18

AY578845

DMOJX510

 

X

169

atttggctgctgcgagacg

gatttgtgccactgtgcaatgg

(ag)18

AY578846

DMOJX511

 

X

177

gcttcagtgagcctcaaatgaaac

tgcagctggcatgggtataag

(ct)16

AY578847

DMOJ2010

 

2

157

acgagtttgccatgaactggattg

aaagccgaaacttgtattcatttggc

(ac)14

AY578848

DMOJ2020

 

2

153

attgacttagcgtgtgagcgtg

cgctgtctcatttacataggtcgg

(gt)7

AY578849

DMOJ2030

 

2

199

tgacgcgccaatcagttgac

gattcaaggtgtcatatctatatgtgtgtagg

(gt)16

AY578850

DMOJ2100

4e-05

2

187

ggcgctcccttaatcacagatac

agcatgtgtctgcttgctgt

(ag)17

AY578851

DMOJ2200

3e-21

2

148

gtcgctccatagagttctacaagtttg

cgcctccaagtaattcacgaagc

(gt)9

AY578852

DMOJ2210

 

2

139

cccagcaagtgtactctactcaag

tgctgcatcaataaagaaggcaaac

(ca)8

AY578853

DMOJ2220

0.002

2

136

gttggctttggctattggactgag

tgtgcaatgtgactggcaactg

(gt)6

AY578854

DMOJ2300

1e-05

2

114

aattgacagcactccgtggc

gttcagcgccggccttac

(ca)12

AY578855

DMOJ2301

 

2

158

ctcttagcggcaggtgtcaag

aatcttatcgaaaatatgcaacacgatgg

(caa)11

AY578856

DMOJ2302

8e-17

2

193

ctctcgctgtttctcttgtctcttatac

aactgatttaccgctcgctatacag

(ac)9

AY578857

DMOJ3010

4e-05

3

218

gcccgccggagttcaatag

atgtgtatggccagtgctacattt

(ct)8

AY578858

DMOJ3020

4e-23

3

94

acgtggattacgaacacgagc

tttggccaatttgagcaactgc

(ca)14

AY578859

DMOJ3030

 

3

91

cctagtttctttggccaccctac

cgcagtgaaacgcatggaaac

(ca)11

AY578860

DMOJ3040

 

3

94

gtcaggtgtcagcagcagc

gcctcaacagcacctactgag

(ac)12

AY578861

DMOJ3100

 

3

87

ctgatttgtcaccacagggactc

gctaatcgaagcacacacatgtattcag

(ca)10

AY578862

DMOJ3101

7e-25

3

150

aacggcggcatccgttg

actgtcatcgcacaaatgatttgta

(gt)12

AY578863

DMOJ3102

 

3

210

ctctctgtagcaaaaggcttttgtaacc

tgctgtgtgcagcacgaac

(ca)11

AY578864

DMOJ4010

 

4

90

agccagtgcaatgccagc

gcctggaccttgtgggc

(ca)16

AY578865

DMOJ4020

 

4

121

cagcagctgccttatgtcagc

aataaatcgcagcagccaggac

(ac)10

AY578866

DMOJ4030

7e-05

4

137

gtagttgttgtaggcacgcataca

aatgagaatgagaactggaacggg

(ca)10

AY578867

DMOJ4040

1e-07

4

161

gcaacatgtgctccactcgttc

ttttcccacacttcttgcagcag

(ca)11

AY578868

DMOJ4050

 

4

196

atcgcatagaaagacactcatacgc

ctggaggcaagggaagtttcg

(ca)9

AY578869

DMOJ4060

 

4

211

cgagactcgctgataagtaaagcc

gattgtaattttggccgtgcgc

(ac)41

AY578870

DMOJ4100

 

4

126

cgcagacatatttgtctcccagc

ttcgtagccaagacaaactcacaac

(ga)11

AY578871

DMOJ4200

3e-10

4

120

gcttcaagccttgtgatttgttg

caagaagaacaagcgcattatgcaaa

(ct)24

AY578872

DMOJ4300

 

4

165

ggaaagaataccaacgcctatggc

gtccgcagacagccagc

(ca)12

AY578873

DMOJ4301

 

4

133

acatttggctgttacctggcac

ccaatgccagtgagtttctctctc

(ca)12

AY578874

DMOJ4302

2e-42

4

218

gtgtgtgcgtggatgtgttttac

gacagcactgaacagattatagataagcc

(ag)18

AY578875

DMOJ4303

 

4

174

cacggcaacacttgcagttacc

ccattgctcatagcccgtttacc

(ag)23

AY578876

DMOJ4304

 

4

171

ggcacattgccacaagtgtac

tctgtgccggaaatcgtcaac

(ga)20

AY578877

DMOJ5010

6e-04

5

117

ggcatagggaccgcagc

gtaaatattcgccaaacacctacatgc

(ac)8

AY578878

DMOJ5020

4e-06

5

144

ctacaggtatgaagaacctgaaccc

acaacagcctacacgcactc

(gt)11

AY578879

DMOJ5100

8e-18

5

156

agacaacttgactgttgctcgc

tgacactgattggtcgctgtg

(gt)8

AY578880

DMOJ5200

2e-26

5

154

tcgcacaactggcgcatg

atttttacagcacgcttaacaagaattttcac

(ca)13

AY578881

DMOJ5300

 

5

97

gtggtggacatcaaccagcc

tgagccaactttgagcataaattagcc

(ca)9

AY578882

DMOJ5400

5e-08

5

109

cttggatttcagctcagtcgctc

cgccacaatcagtcataggtcc

(gt)10

AY578883

DMOJ5500

 

5

121

ggaagcgtcgactgcatacc

gtgttgaaacgtatgtgtttgtgcc

(ca)10

AY578884

DMOJ5501

1e-04

5

99

cgtgccacgtaaactcttgcc

gaaggcaattcaattagttttgagagttatccc

(ac)9

AY578885

DMOJ5502

 

5

115

gcatattgacaaggacgagctgtc

tctgagtgcgtccattactttgtatc

(gt)12

AY578886

DMOJ5503

 

5

150

gtatacgacatgttggcactgcc

ttgcaagctgggcgtaagc

(tg)10

AY578887

DMOJA500

 

A

185

gagactgtttgacgcccgc

tcgatagacatgagtttggtctagaaacc

(tg)8

AY578888

DMOJA501

 

A

140

tcagtagcctctgctacggc

cgaacggaaattatgaactagtcagcc

(tc)30

AY578889

DMOJA502

 

A

138

ctgaaagttctggcagcaagagt

gtgtaatttagttgttagacgcgattgagag

(ct)14

AY578890

DMOJA503

 

A

153

taaggctctgtttcgtaactttgcc

ctgtcaatgtgctaaacattgcaacc

(ca)9

AY578891

DMOJA504

 

A

222

aatcatctgccccctttccac

ggaaaatgatgctcaggcaggt

(ac)13

AY578892

DMOJA505

 

A

181

ccatagtgcgatgcacgcttc

gccatagcccatagtagccaag

(tg)10

AY578893

DMOJA506

 

A

147

attaatgcaggccggaaagtcg

gctcgctctgcgtcgttatg

(gt)11

AY578894

DMOJA507

 

A

134

tcagccgggatgttaactaacttg

atgcttaccagagcgaatggc

(ac)12

AY578895

DMOJA508

 

A

196

ctctgcgacatgtagactacgc

gataaagttgaacttttactaccgatgcattc

(tg)10

AY578896

DMOJA509

 

A

186

gctgagaaacaaatttcgcatgcc

tgttgttgtcctttaacgaacgttcc

(tg)18

AY578897

DMOJA510

 

A

105

cacacagccagacttgacgttag

gcttttgattttgtcatagccattgctaaac

(tg)12

AY578898

DMOJA511

 

A

162

cttttctggctattacgagagcagc

aaaacataatgtaattgagctgacaaagcaac

(tg)30

AY578899

DMOJA512

 

A

120

gatgagaaataggcgttgctgtcc

gcatatgatgaaggctgagagctc

(ca)11

AY578900

DMOJA513

 

A

120

gctcagctaacagaaacaccca

gccgtagctgcagcatct

(tg)13

AY578901

DMOJA514

 

A

125

atggcgcaactcggtcg

gcagcacatttggctgctg

(gt)12

AY578902

DMOJA515

 

A

203

gaccgaacagcgcagcc

cacaaacctacataaacaccgcagtc

(ac)11

AY578903

DMOJA516

 

A

163

ggctgtaccaagcacacactc

cgctcgtgtcgtcgtcttc

(ca)13

AY578904

DMOJA517

 

A

87

gaaaacagctgcaaacccgtaaag

gctctcttaagcgctcaactatatagac

(ca)15

AY578905

DMOJA518

 

A

118

gtatgtatgggcatacagcggg

cttggttctatgatatgatgacgtgtct

(ca)7

AY578906

DMOJA519

 

A

182

atgaataggaatccagccagcg

agcgctttgcgtgcctac

(ca)14

AY578907

DMOJA520

 

A

164

tttcggcgcaaggtcgtc

ttagcttctttaccggcatcatgc

(gt)8

AY578908

DMOJA521

 

A

96

ttttgtttaggttttgcgcctaacc

ttttccataatttgtgcgtgtgcc

(ac)9

AY578909

DMOJA522

 

A

122

cctttcgagtgcctccacaac

gtcccactacatattgctacagctg

(ca)11

AY578910

DMOJA523

 

A

147

gcgtaagcacagttggactctc

tgtctgcggagttttatgctgtaa

(ct)23

AY578911

DMOJA524

 

A

135

tcgagagagattcgatcgagagc

cctgtttgcattatgtgggtgtc

(ac)12

AY578912

Conclusions

We have developed and mapped a panel of 90 variable microsatellites for genetic studies in a model system for ecological genetics and speciation: Drosophila mojavensis. Thirty-four of these microsatellites have been placed onto a detailed linkage map of this species. We also confirmed that Muller's chromosome elements were conserved between D. melanogaster and D. mojavensis, species separated by 65 million years of independent evolution, in 23 of 65 sequences tested. Given the long-term interest in this species for studies of adaptation and speciation, the construction of a linkage map and presentation of variable microsatellite sequences will facilitate future work in this area.

Methods

Isolation of microsatellite sequences

We used a modification of Hamilton et al's [21] enrichment technique to increase the proportion of microsatellites in the genomic DNA insert library prior to cloning [see also [22]]. This procedure uses a subtractive hybridization, in which streptavidin-coated magnetic beads and biotinylated oligonucleotide repeats retain single-stranded genomic DNA fragments containing repeat sequences.

Genomic DNA was isolated from approximately 30 D. mojavensis individuals from a mixture of strains using the Puregene™ DNA Isolation Kit (Gentra Systems). Except where indicated, we used reagent concentrations and reaction conditions suggested by Hamilton et al [21]. The enrichment procedure was repeated seven times. For each enrichment, one of the following enzymes was used with Nhe I to digest Drosophila mojavensis genomic DNA: Sau 3AI, Bfuc I, Rsa I, Alu I, or HpyCH4 III. Linker sequences were ligated to the digested DNA to provide a PCR priming site. We then hybridized the digested, linker-ligated DNA to a biotinylated oligonucleotide repeat motif, either (CA)15 or (AG)15, and recovered the microsatellite-enriched DNA. The DNA was amplified via PCR, and fragments between 300 and 800 bp were recovered from an agarose gel for cloning. We then used the Invitrogen TOPO-TA cloning kit to clone the DNA into plasmids and transform into E. coli. We omitted the chemiluminescent screen and used pUC19 primers to amplify D. mojavensis DNA inserts directly from colonies. Each 50 μl reaction volume contained 50 mM Tris-HCl (pH 8.3), 20 mM KCl, 1.5 mM MgCl2, 0.2 mM each dNTP, 0.5 μM pUC forward and reverse primers, and 1.0 unit Taq polymerase (AmpliTaq, Perkin Elmer). DNA was added by touching a sterile toothpick to a colony and swirling the toothpick into the reaction mix. We used the following thermal profile: 95°C for 5 min; 30 cycles of 94°C for 60 s; 55°C for 30 s, 55°C for 30 s, 72°C for 30 s; rapid thermal ramp to 40°C. PCR products were sequenced with an ABIPrism® Big Dye™ Terminator Cycle Sequencing Ready Reaction Kit, and products were visualized on ABI sequencers in the LSU Museum of Natural Science, Pennington Biomedical Research Center, or the Department of Biological Sciences' genomics facility.

Fly stocks

Several inbred lines of D. mojavensis were tested to determine the most suitable lines for constructing a microsatellite map based on microsatellite allelic differences between strains, bearing the same chromosomal arrangements, and lack of segregating microsatellite alleles. In the end, we selected the lines A993 (Rancho El Diamante, Sonora) and A924 (St. Rosa Mtns., AZ), obtained from Dr. William J. Etges. These lines were further brother-sister mated for 9–12 generations to ensure thorough inbreeding and a reduction of segregating alleles.

Microsatellite assay conditions

We designed two primers for each microsatellite-bearing sequence, one bearing an M13(-29) tail. A 10 μL PCR reaction was then performed using 0.5 μM of each primer, 1.0 μL of dNTPs, 1.0 μL of 10X PCR buffer (100 mM Tris pH 8.3, 500 mM KCl, 15 mM MgCl2), 0.4 μL of IRDye (LiCor), 1U Taq DNA polymerase, and 0.5 μL from a single fly DNA preparation (Puregene). We sometimes added 1.0 μL of 10 mM MgCl2 to the reaction or more polymerase to optimize the results of the PCR. A touchdown PCR cycle was performed [23], and amplifications were visualized on acrylamide gels on our LiCor DNA analyzer.

Assignment to linkage groups

Virgin females and males of the A993 and A924 lines were crossed and offspring reared. DNA was isolated from the parents and progeny using the Puregene™ DNA Isolation Kit (Gentra Systems). We determined if markers differentiating the lines were X-linked or autosomal by comparing the F1 males to the F1 females and parent strains. For X-linked markers, males consistently bore one allele while females consistently bore two. Autosomal markers were further tested using 20 progeny of a male-parent backcross. Because there is no recombination in Drosophila males, the offspring all inherited a nonrecombinant chromosome from one of the original lines. By comparing genotypes across the male-parent backcross progeny, markers were assigned to linkage groups. We also used the NCBI Basic Local Alignment Search Tool [BLAST: [18]] to identify putatively homologous sequences in D. melanogaster. Sequences bearing an expect (E) value below 0.01 were scored, as E-values are nearly identical to probability (p) values in that range.

Recombinational mapping within linkage groups

Virgin F1 females (progeny of the cross described in "Assigning to linkage groups") were backcrossed to males of one of the pure lines (A924). To ascertain the recombinational distances between the markers on each chromosome, we genotyped the parents and 200 progeny with each marker previously assigned to a linkage group. Recombinational distances were estimated in Kosambi centiMorgans using Mapmaker [24].

Declarations

Acknowledgements

This research was supported by National Science Foundation grants 9980797, 0211007, and 0314552, and Louisiana Board of Regents Governor's Biotechnology Initiative grant 005 to MAFN and a Sigma Xi grant-in-aid of research to SDS. We thank William J. Etges for providing fly stocks and moral support, Daniel Ortiz-Barrientos, Christy Henzler, and three referees for constructive comments on this manuscript, and Lisa Burk for technical assistance.

Authors’ Affiliations

(1)
Department of Biological Sciences, Louisiana State University
(2)
Pennington Biomedical Research Center, Louisiana State University

References

  1. Ruiz A, Heed WB, Wasserman M: Evolution of the mojavensis cluster of cactophilic Drosophila with descriptions of two new species. J Hered. 1990, 81: 30-42.PubMedGoogle Scholar
  2. Etges WJ: Premating isolation is determined by larval substrates in cactophilic Drosophila mojavensis. Evolution. 1992, 46: 1945-1950.View ArticleGoogle Scholar
  3. Zouros E: The chromosomal basis of sexual isolation in two sibling species of Drosophila: D. arizonensis and D. mojavensis. Genetics. 1981, 97: 703-718.PubMed CentralPubMedGoogle Scholar
  4. Wasserman M, Koepfer HR: Character displacement for sexual isolation between Drosophila mojavensis and Drosophila arizonensis. Evolution. 1977, 31: 812-823.View ArticleGoogle Scholar
  5. Etges WJ, Ahrens MA: Premating isolation Is determined by larval-rearing substrates in cactophilic Drosophila mojavensis. V. Deep geographic variation in epicuticular hydrocarbons among isolated populations. Am Nat. 2001, 158: 585-598. 10.1086/323587.View ArticlePubMedGoogle Scholar
  6. Zouros E: The chromosomal basis of viability in interspecific hybrids between Drosophila arizonensis and Drosophila mojavensis. Can J Genet Cytol. 1981, 23: 65-72.View ArticleGoogle Scholar
  7. Pantazidis AC, Galanopoulos VK, Zouros E: An autosomal factor from Drosophila arizonae restores spermatogenesis in Drosophila mojavensis males carrying the D. arizonae Y chromosome. Genetics. 1993, 134: 309-318.PubMed CentralPubMedGoogle Scholar
  8. Miller GT, Starmer WT, Pitnick S: Quantitative genetic analysis of among-population variation in sperm and female sperm-storage organ length in Drosophila mojavensis. Genet Res Camb. 2003, 81: 213-220. 10.1017/S0016672303006190.View ArticleGoogle Scholar
  9. Pitnick S, Miller GT, Schneider K, Markow TA: Ejaculate-female coevolution in Drosophila mojavensis. Proc Roy Soc Lond B. 2003, 270: 1507-1512. 10.1098/rspb.2003.2382.View ArticleGoogle Scholar
  10. Ross CL, Dyer KA, Erez T, Miller SJ, Jaenike J, Markow TA: Rapid divergence of microsatellite abundance among species of Drosophila. Mol Biol Evol. 2003, 20: 1143-1157. 10.1093/molbev/msg137.View ArticlePubMedGoogle Scholar
  11. Muller HJ: Bearings of the Drosophila work on systematics. In New Systematics. Edited by: Huxley J. 1940, Oxford: Clarendon Press, 185-268.Google Scholar
  12. Powell JR: Progress and Prospects in Evolutionary Biology: The Drosophila Model. New York: Oxford University Press. 1997Google Scholar
  13. Whiting JH, Pliley MD, Farmer JL, Jeffery DE: In situ hybridization analysis of chromosomal homologies in Drosophila melanogaster and Drosophila virilis. Genetics. 1989, 122: 99-109.PubMedGoogle Scholar
  14. Papaceit M, Juan E: Chromosomal homologies between Drosophila lebanonensis and D. melanogaster determined by in situ hybridization. Chromosoma. 1993, 102: 361-368. 10.1007/BF00661280.View ArticlePubMedGoogle Scholar
  15. Gallego P, Juan E, Papaceit M: Chromosomal homologies between Drosophila melanogaster and D. funebris determined by in-situ hybridization. Chromosome Res. 1999, 7: 331-339. 10.1023/A:1009207812569.View ArticlePubMedGoogle Scholar
  16. Ranz JM, Segarra C, Ruiz A: Chromosomal homology and molecular organization of Muller's elements D and E in the Drosophila repleta species group. Genetics. 1997, 145: 281-295.PubMed CentralPubMedGoogle Scholar
  17. Schafer DJ, Fredline DK, Knibb WR, Green MM, Barker JSF: Genetics and linkage mapping of Drosophila buzzatii. J Hered. 1993, 84: 188-194.PubMedGoogle Scholar
  18. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol. 1990, 215: 403-410. 10.1006/jmbi.1990.9999.View ArticlePubMedGoogle Scholar
  19. Wasserman M: Evolution of the repleta group. In The Genetics and Biology of Drosophila. 3b. Edited by: Ashburner M, Carson HL, Thompson JN. 1982, London: Academic Press, 61-139.Google Scholar
  20. Wasserman M: Cytological evolution of the Drosophila repleta species group. In Drosophila Inversion Polymorphism. Edited by: Krimbas CB, Powell JR. 1992, Boca Raton, FL: CRC Press, 455-552.Google Scholar
  21. Hamilton MB, Pincus EL, DiFiore A, Fleischer RC: Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. BioTechniques. 1999, 27: 500-507.PubMedGoogle Scholar
  22. Kandpal RP, Kandpal G, Weissman SM: Construction of libraries enriched for sequence repeats and jumping clones, and hybridization selection for region-specific arkers. Proc Natl Acad Sci USA. 1994, 91: 88-92.PubMed CentralView ArticlePubMedGoogle Scholar
  23. Palumbi SR: Nucleic Acids II: The Polymerase Chain Reaction. In Molecular Systematics. Edited by: Hillis DM, Moritz C, Mable BK. 1996, Sunderland, Mass.: Sinauer Associates, Inc, 205-247.Google Scholar
  24. Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln SE, Newburg L: MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics. 1987, 1: 174-181. 10.1016/0888-7543(87)90010-3.View ArticlePubMedGoogle Scholar

Copyright

© Staten et al; licensee BioMed Central Ltd. 2004

This article is published under license to BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.

Comments