Open Access

Discovery, linkage disequilibrium and association analyses of polymorphisms of the immune complement inhibitor, decay-accelerating factor gene (DAF/CD55) in type 1 diabetes

  • Hidenori Taniguchi1,
  • Christopher E Lowe1,
  • Jason D Cooper1,
  • Deborah J Smyth1,
  • Rebecca Bailey1,
  • Sarah Nutland1,
  • Barry C Healy1,
  • Alex C Lam1,
  • Oliver Burren1,
  • Neil M Walker1,
  • Luc J Smink1,
  • Linda S Wicker1 and
  • John A Todd1Email author
BMC Genetics20067:22

DOI: 10.1186/1471-2156-7-22

Received: 22 February 2006

Accepted: 20 April 2006

Published: 20 April 2006

Abstract

Background

Type 1 diabetes (T1D) is a common autoimmune disease resulting from T-cell mediated destruction of pancreatic beta cells. Decay accelerating factor (DAF, CD55), a glycosylphosphatidylinositol-anchored membrane protein, is a candidate for autoimmune disease susceptibility based on its role in restricting complement activation and evidence that DAF expression modulates the phenotype of mice models for autoimmune disease. In this study, we adopt a linkage disequilibrium (LD) mapping approach to test for an association between the DAF gene and T1D.

Results

Initially, we used HapMap II genotype data to examine LD across the DAF region. Additional resequencing was required, identifying 16 novel polymorphisms. Combining both datasets, a LD mapping approach was adopted to test for association with T1D. Seven tag SNPs were selected and genotyped in case-control (3,523 cases and 3,817 controls) and family (725 families) collections.

Conclusion

We obtained no evidence of association between T1D and the DAF region in two independent collections. In addition, we assessed the impact of using only HapMap II genotypes for the selection of tag SNPs and, based on this study, found that HapMap II genotypes may require additional SNP discovery for comprehensive LD mapping of some genes in common disease.

Background

T1D is characterised as a common autoimmune disease, mainly resulting from a T-cell mediated destruction of pancreatic beta cells that leaves patients completely dependent on exogenous insulin to regulate their blood glucose level. T1D is strongly clustered in families with an overall genetic risk ratio, an estimate of the familial clustering of the disease, of approximately 15[1]. However, of the hundreds of association studies reported to date, only four loci have been identified and successfully replicated: the HLA class II genes on chromosome 6p21[2]; the insulin gene (INS) on chromosome 11p15[3, 4]; CTLA4 on chromosome 2q33[5, 6]; and PTPN22 on chromosome 1p13[7, 8]. CD25 on chromosome 10p15 has been implicated, but this finding awaits independent replication[9]. Given that these genes alone cannot explain the familial clustering of T1D, many other genes remain to be identified.

Recently, there have been several reports focusing on the relationship between autoimmune disease and the complement system, which is composed of more than 30 soluble and membrane-bound proteins[10, 11] and plays an important role in innate host defence. As inappropriate regulation of the complement system can lead to significant damage of host tissues[12], a number of membrane-bound complement regulatory proteins are active, such as DAF, a glycosylphosphatidylinositol-anchored membrane protein that restricts complement activation by inhibiting the formation of C3 convertases in both the classical and alternative pathways[13, 14].

Dysfunction of human DAF on erythrocytes contributes to the paroxysmal nocturnal hemoglobinuria (PNH) by increasing their sensitivity to complement lysis[13, 15, 16]. In addition, a proportion of DAF-deficient (Cromer INAB) patients develop inflammatory bowel disease. However, little is known about DAFs role in autoimmune disease in vivo[17].

Recently, it has been reported that DAF modulates T cell immunity by controlling T cell- and antigen-presenting cell- induced alternative pathway of C3 activation during cognate interactions [1820]. According to gene targeting studies, mice deficient in the DAF1 gene, the murine homologue of human DAF, showed more susceptibility to complement mediated inflammatory injury, especially DAF1 deficient female mice in a MRL/lpr background, a model for human systemic lupus erythematosus, which showed aggravated lymphadenopathy and splenomegaly, higher serum anti-chromatin autoantibody levels, and dermatitis[21].

Given this prior evidence, DAF may function as a negative regulator of autoimmune response by modulating T cell activity and directly protecting host tissues in vivo and that recombinant DAF may be an ideal therapeutic agent for autoimmunity[22]. On the other hand, DAF does not lie under any of the reported T1D linkage peaks[23, 24] nor have there been any reports of genetic association studies between DAF and autoimmune disease, although recently differential expression of DAF was observed when comparing T cells from nonobese diabetic (NOD) mice and diabetes-resistant NOD mice having a congenic interval containing the DAF gene thereby making it a candidate gene for the Idd5.4 region (William Ridgway and Linda Wicker, unpublished observations).

In this study, to elucidate the susceptibility of DAF with T1D, we performed an association study using a LD mapping approach, together with the direct analysis of three non-synonymous SNPs (nsSNPs) in large case-control and family collections.

Results

Linkage disequilibrium analysis

Initially, we used phase II genotyping data from the HapMap project[25, 26], a catalogue of common human genetic variants, providing their allele frequencies and intermarker LD patterns among people, within and among populations from African, Asian, and European ancestry. In the DAF region, about 40 kb on chromosome 1q32, 21 common SNPs (minor allele frequency (MAF) ≥ 0.05), have been genotyped in 60 U.S.A. residents with northern and western European ancestry, collected in 1980 by the Centre d'Etude du Polymorphisme Humain (CEPH, CEU). We note that all of these SNPs were located in non-coding regions and that the average inter-SNP distance was 2 kb. A LD map of the region, using pairwise D', shows little evidence of recombination within the region (Figure 1a).
Figure 1

LD map for human DAF region on Chromosome 1q32. All markers with the MAF of less than 0.05 or with insufficient genotyping data were excluded in the LD measurement. a. LD map with 21 markers genotyped in 60 individuals obtained from HapMap II. b. LD map with 22 markers identified by resequencing with 32 CEPH's individuals. figure c. LD map with 38 markers, a combined dataset of both HapMap II and in-house resequencing data with 32 CEPH's individuals.

DAF resequencing

As we were concerned about adopting a LD mapping approach given the HapMap SNP density[27], we resequenced DAF in 32 CEPH individuals, selected from the 60 CEPH individuals used by the HapMap project, to increase the SNP density across the region.

Analysis of the resequencing data identified 32 polymorphisms, 26 of which were SNPs and six were deletion/insertion polymorphisms (DIPs), of which 12 SNPs and four DIPs were novel when compared to dbSNP build 125 (Table 1). Twenty-two polymorphisms were common (MAF ≥ 0.05), five of which were also found in the HapMap II data. The relatively small number of common polymorphisms found in both datasets is not unexpected, as HapMap II SNPs were selected to provide an even coverage in terms of distance across the genome, whereas the resequencing is focused on regions of interest and extracts all common polymorphisms present in these individuals. A LD map of the region, based on these 22 polymorphisms (Figure 1b), revealed additional evidence of recombination within the region over and above that apparent in HapMap II data alone (Figure 1a). There was a breakdown in LD towards the 5' end of DAF that was not evident in HapMap II data.
Table 1

Polymorphisms identified in human DAF. Map positions on human chromosome 1 were from NCBI build 35. Selected tag SNPs are in boldface. Alleles are coded Major > Minor. MAF calculated from the 32 individuals used for tag SNP selection, except for nsSNPs, in which case the MAF is calculated from genotyped controls. DIL = identified by in-house resequencing, HapMap = identified in HapMap II dataset, DIL&HapMap II = Identified in both in-house resequencing and HapMap II dataset.

Polymorphism – dbSNP(build125)

Location

MAF

AllelicR2

Dataset

 

Position(NCBI35)

Gene

   

ss49853051(G > C)

203881344

promoter

0.03

-

DIL

ss49853052(C > T)

203881734

promoter

0.03

-

DIL

rs6685886(C > A)

203882613

promoter

0.46

85.07

DIL

rs2564978(C > T)

203882811

promoter

0.33

tag SNP

DIL & HapMap

rs3841376 (TAGTTACTTCCCCTCCTTCCC > -)

203882879

promoter

0.33

100.00

DIL

ss49853053(A > G)

203883074

promoter

0.26

tag SNP

DIL

ss49853054(T > C)

203883723

intron 1

0.02

-

DIL

rs7533852(G > T)

203883822

intron 1

0.44

89.15

DIL

ss49853055(TA > -)

203884424

intron 2

0.03

-

DIL

rs4844590(C > T)

203884524

intron 2

0.23

tag SNP

DIL

rs2782828(G > T)

203885394

intron 2

0.24

94.47

HapMap

ss49853056(A > G)

203886206

intron 2

0.03

-

DIL

ss49853057(C > G)

203887670

intron 4

0.13

tag SNP

DIL

ss49853058(G > A)

203888427

intron 4

0.03

-

DIL

rs4844591(T > C)

203888688

intron 5

0.33

90.27

DIL & HapMap

rs4844592(A > T)

203889606

intron 5

0.33

90.27

HapMap

rs6703002(G > T)

203890767

intron 5

0.32

88.10

HapMap

rs6700168(C > A)

203890929

intron 5

0.38

82.68

HapMap

rs925130(A > G)

203891827

intron 5

0.33

100.00

HapMap

rs925131(G > A)

203892116

intron 5

0.33

90.27

HapMap

ss49853059(C > T)

203892582

intron 5

0.02

-

DIL

rs2184476(A > G)

203893064

intron 6

0.45

tag SNP

DIL

rs1507757(A > C)

203893143

intron 6

0.35

tag SNP

DIL

rs6662070(G > A)

203894104

intron 6

0.31

100.00

HapMap

rs1507758(C > G)

203895876

intron 6

0.33

90.27

HapMap

rs1507759(G > A)

203896023

intron 6

0.32

100.00

HapMap

rs12075906(A > G)

203896494

intron 6

0.33

100.00

HapMap

rs1354942(A > G)

203896887

intron 6

0.33

90.27

HapMap

rs7555030(G > A)

203897125

intron 6

0.33

100.00

HapMap

rs7544288(G > A)

203897417

intron 6

0.41

97.09

HapMap

rs1507760(T > C)

203897760

intron 6

0.33

100.00

HapMap

rs1507761(C > T)

203898194

intron 6

0.33

100.00

HapMap

ss49853060(C > T)

203898910

intron 7

0.04

-

DIL

rs10746462(G > A)

203898943

intron 7

0.33

90.27

DIL

rs10746463(A > G)

203898991

intron 7

0.33

90.27

DIL & HapMap

ss49853061(G > A)

203899255

intron 8

0.02

-

DIL

rs2135923(G > A)

203914988

intron 10

0.33

90.27

HapMap

ss49853066(- > TT)

203921271

intron 10

0.39

97.09

DIL

ss49853062(A > G)

203922987

3'

0.02

-

DIL

rs11120766(A > G)

203923074

3'

0.45

84.94

DIL

rs1507765(A > C)

203923641

3'

0.45

84.94

DIL & HapMap

rs11307618(A > -)

203923723

3'

0.41

97.09

DIL

ss49853063(A > G)

203923730

3'

0.41

97.09

DIL

ss49853064(C > -)

203923933

3'

0.39

91.71

DIL

rs12066318(T > C)

203924026

3'

0.33

tag SNP

DIL

ss49853065(- > ATG)

203924418

3'

0.45

84.94

DIL

rs11120769(G > T)

203925240

3'

0.45

83.28

DIL

rs11117564(C > A)

203925366

3'

0.45

90.45

DIL & HapMap

nsSNPs

     

rs28371588(>)

203884176

Exon 2

0.05

-

 

DAF-WESa/b(T > G)

203884266

Exon 2

0.0055

-

 

rs12135160(>)

203899090

Exon 8

-

-

 

Tag SNP analysis of DAF

To test for an association between T1D and the DAF region, we adopted a LD mapping approach, which exploits the non-random relationships between SNPs (known as LD) in a region of interest to reduce the amount of genotyping required. As the causal SNP is unknown, we assume that predicting the causal SNP is likely to be no more difficult than predicting any other SNP. The predictive performance of the tag SNPs was assessed using a R2 measure, which measures the ability to predict each known SNP by multiple regression on the set of tag SNPs. The tag SNPs were analysed using a multilocus test, as described by Chapman et al[28], which tests for an association between the tag SNPs and T1D due to LD with one or more causal variants[28, 29].

We first combined our resequencing data with the HapMap data, providing a panel of 38 common polymorphisms genotyped in 32 individuals (Table 1), and generated a combined LD map of the region (Figure 1c). Subsequently, seven tag SNPs were selected[9] from the 38 common polymorphisms, required to capture the variation within the DAF region with a minimum R2 of 0.80[28] (Table 1). The tag SNPs were genotyped in 3,523 cases and 3,817 controls, and in 725 Caucasian multiplex T1D families (Table 2). The case-control and family multilocus P-values were 0.12 (3,523 case and 3,817 control genotypes; F7,7321 = 1.63) and 0.69 (parent-child trio genotypes = 1,390; χ72 = 4.72), respectively, providing no evidence for the association between T1D and the DAF region. In the case-control collection, the multilocus test was stratified by broad geographical within the UK in order to minimize any confounding due to variation in allele frequencies across Great Britain[9, 30].
Table 2

Genotyping data of tag SNPs. The number of individuals with each genotype in case-control data and the number of alleles in family data are indicated. T, Transmitted. UT, Untransmitted. MAF, minor allele frequency calculated from either control samples or parents.

 

Case-Control

Family

SNP

Population

MAF

1/1

1/2

2/2

Population

MAF

Number of Trios

T

UT

rs2564978(C > T)

Case

0.31

1648

1468

318

UK

0.32

738

483

458

 

Control

0.31

1791

1622

354

USA

0.27

526

272

289

ss49853053(A > G)

Case

0.25

1895

1305

219

UK

0.24

736

345

350

 

Control

0.24

2147

1338

231

USA

0.29

536

317

304

rs4844590(C > T)

Case

0.23

1987

1194

193

UK

0.21

711

287

309

 

Control

0.22

2288

1251

195

USA

0.26

517

272

270

ss49853057(C > G)

Case

0.07

2914

465

22

UK

0.08

709

113

101

 

Control

0.08

3071

580

17

USA

0.06

527

62

62

rs2184476(A > G)

Case

0.31

1607

1447

314

UK

0.33

723

475

442

 

Control

0.31

1757

1578

345

USA

0.27

492

249

268

rs1507757(A > C)

Case

0.31

1660

1469

319

UK

0.33

736

484

479

 

Control

0.31

1756

1586

349

USA

0.27

476

246

248

rs12066318(A > G)

Case

0.44

658

1679

1104

UK

0.43

751

866

859

 

Control

0.45

738

1868

1135

USA

0.44

538

597

605

Analysis of DAF non-synonymous SNPs

Recently, it has been proposed that complex diseases such as T1D may result from the effects of a large number of rare variants, with substantial allelic heterogeneity at causal loci[31, 32]. In DAF, several rare non-synonymous SNPs (nsSNPs) were reported in the exons encoding the short consensus repeat (SCR) domains of the DAF protein, which have subsequently been shown to be related with antigen of the Cromer blood group system[13, 14, 33, 34]. On the basis of the rare variant hypothesis, we genotyped three rare nsSNPs in3,490 cases and 3,814 controls (Table 3), under the hypothesis that a rare functional variant in DAF might have a strong effect in T1D. The following three nsSNPs were assessed: DAF-WESa/b(G > T) located in exon 2 with a MAF of 0.0055–0.0060 in a Finnish population[35, 36]; rs28371588(C > A), also located in exon 2[34]; and, rs12135160(G > A), identified by SsahaSNP detection tool (NIH and Sanger Institute, UK) in exon 8 and not previously genotyped. All result in amino-acid substitutions, but their phenotypic influences have not been characterized. In the present study, the MAF of rs12135160(G > A) was 0.00042 in 3,768 controls, and consequently, we have no statistical power to detect an association. Both rs28371588(C > A) and DAF-WESa/b(G > T) were monomorphic in the case-control collection.
Table 3

Genotyping data of non-synonymous SNPs. The numbers of individuals with each genotype in case-control data are indicated. MAF, minor allele frequency calculated from control samples.

SNP

Population

MAF

1/1

1/2

2/2

rs28371588(C > A)

Case

0

3420

0

0

 

Control

0

3748

0

0

DAF-WESa/b(T > G)

Case

0

3438

0

0

 

Control

0

3738

0

0

rs12135160(G > A)

Case

0.0004

3437

3

0

 

Control

0.0004

3765

3

0

Discussion

In this study, we did not find any evidence for an association between T1D and the DAF region in large case-control and family collections using a LD mapping approach. We combined the HapMap II genotyping data and resequencing data, for the selection of tag SNPs. Had we chosen the tag SNPs using only the HapMap II genotyping data, only two tag SNPs (rs2564978 and rs1507765) were required to capture the detected variation within the ~40 kb DAF region with a minumum R2 of 0.8. However, when the predictive performance of the two tag SNPs were applied to the combined sequence dataset, they no longer captured the variation within the region to the required level since seven of the thirty-six common polymorphisms had an R2 below 0.8. The inability of the tag SNPs selected from HapMap II data to tag the combined dataset (minimum R2 = 0.35) suggests that for the analysis of localized regions containing candidate genes, as opposed to whole-genome association studies, HapMap II data alone may not provide sufficient information to facilitate a comprehensive LD-mapping approach. In the tag SNP approach, as the causal variant is unknown, we assume that the problem of predicting the causal polymorphism is likely to be no more difficult than that of predicting any other polymorphism[28]. Consequently, the power of the tag SNP approach to detect a causal polymorphism is based upon the minimum R2[28], assuming that the majority of common polymorphisms in a region are known. In this instance, incomplete knowledge of the common polymorphisms in a region inflated the minimum R2, providing false confidence in the ability of the tag SNPs to capture the variation within a region, and in the power to detect a causal variant. Our results indicate that for some genes/regions HapMap II data may need to be supplemented by additional resequencing data to allow comprehensive association mapping of common variants.

Conclusion

We conclude that variation in DAF itself is unlikely to have a major effect in T1D in these populations. Analysis of an extended region, surrounding the DAF region analysed in this study, showed a cluster of several other genes involved in the complement system, including C4b binding protein (C4bp) and membrane cofactor protein (MCP), both known regulators of complement activation (RCA) genes[11, 37, 38]. C4bp and MCP restrict complement activation by inhibiting the formation of C3 convertases in the classical pathways like DAF, suggesting that they modulate each other in direct and indirect ways. To clarify the relation of autoimmune disease and complement system, including DAF, further genetic association studies and functional studies on RCA genes are needed. The set of tag SNPs and the LD map for the DAF region will be useful for such further studies.

Methods

Subjects

The resequencing panel consisted of 32 CEPH individuals; Utah residents with ancestry from Northern and Western Europe collected in 1980 by the Centre d'Etude du Polymorphisme Humain (CEPH).

The 3,523 cases were recruited as part of the Juvenile Diabetes Research Foundation/Wellcome Trust Diabetes and Inflammation Laboratory's United Kingdom Genetic Resource Investigating Diabetes (U.K. GRID) study, which is a joint project between the University of Cambridge Department of Paediatrics and the Department of Medical Genetics at the Cambridge Institute for Medical Research. Most cases were < 16 years of age at the time off collection, all resided in Great Britain, and all were of European descent (self-reported). The 3,817 control samples were obtained from the 1958 British Birth Cohort (1958 BBC), an ongoing follow-up of all person born in Great Britain during one week in 1958 (National Child Development Study)[39]. All cases and control were of white ethnicity.

All families were Caucasian and of European descent, with two parents and at least one affected child. The family collection consisted of 457 multiplex families from the U.K. British Diabetic Association Warren 1 repository[40] and 268 multiplex families from U.S.A. Human Biological Data Interchange[41].

The Cambridge Local Research Ethics Committee gave full ethical approval, and informed consent was obtained for the collection and use of these DNA samples from all subjects.

DAF resequencing

We first annotated the DAF gene locally[42, 43] and displayed the annotation through gbrowse[44] within T1DBase[45], using these annotations we resequenced all 11 exons, exon/intron boundaries and up to 3 kb of 3' and 5' flanking sequence of the DAF gene in 32 CEPH individuals, to increase the SNP density across the region. The sequencing reactions were carried out on nested PCR products using Applied Biosystems (ABI) BigDye terminator v3.1 chemistry and the sequences resolved on an ABI3700 DNA Analyser. Polymorphisms were identified using the Staden Package [46] and double-scored by a second operator.

Statistical analysis

The multilocus test has been described in detail elsewhere[9, 28, 29, 47], briefly, for the case-control data, the multilocus test is essentially Hotellings T2[48, 49], in which we score each diallelic locus as 0, 1 or 2 and compare the mean score vectors between cases and control. In the case of the family data, the multilocus test takes the form of a multilocus TDT[28], in which, for each parent, we calculate a vector whose elements describe transmissions of each of the tag SNPs. If the parent is homozygous at a locus, the corresponding element is scored as zero, otherwise it scored as either +1 or -1 depending on which allele was transmitted. The multilocus test tests the mean of this vector against zero; it is asymptotically distributed as a χ2 with degrees of freedom (df) equal to the number of tag SNPs[28, 47].

The program for the selection of tag SNPs[28] and association analysis used here are implemented in the Stata statistical system and may be downloaded from our website[50].

Genotyping

Genotyping was performed using Taqman MGB (Applied Biosytems Inc, Foster City, CA)[51]. All genotyping data were double-scored to minimize error. All genotyping data were in Hardy-Weinberg equilibrium (P > 0.05). Genotyping failure rates for all assays in both the family and case-control collection were ≤ 6%.

Declarations

Acknowledgements

We gratefully acknowledge the participation of all T1D patients and family members. We thank the Human Biological Data Interchange and Diabetes U.K. for USA and U.K. multiplex families, respectively. We acknowledge use of DNA from the 1958 British Birth Cohort collection, funded by the Medical Research Council grant G0000934 and Wellcome Trust grant 068545/Z/02. DNA samples were prepared by Jayne Hutchings, Gillian Coleman, Trupti Mistry, Kirsi Bourget, Sally Clayton, Matthew Hardy, Jennifer Keylock, Pamela Lauder, Meeta Maisuria, William Meadows, Meera Sebastian, Sarah Wood, The Avon Longitudinal Study of Parents and Children laboratory in Bristol, including Susan Ring, Wendy McArdle, Richard Jones, for preparing DNA samples.

Authors’ Affiliations

(1)
Juvenile Diabetes Research Foundation/Wellcome Trust Diabetes and Inflammation Laboratory, Cambridge Institute for Medical Research, University of Cambridge

References

  1. Risch N: Assessing the role of HLA-linked and unlinked determinants of disease. Am J Hum Genet. 1987, 40: 1-14.PubMedPubMed CentralGoogle Scholar
  2. Cucca F, Lampis R, Congia M, Angius E, Nutland S, Bain SC, Barnett AH, Todd JA: A correlation between the relative predisposition of MHC class II alleles to type 1 diabetes and the structure of their proteins. Hum Mol Genet. 2001, 10: 2025-2037. 10.1093/hmg/10.19.2025.PubMedView ArticleGoogle Scholar
  3. Bell GI, Horita S, Karam JH: A polymorphic locus near the human insulin gene is associated with insulin-dependent diabetes mellitus. Diabetes. 1984, 33: 176-183.PubMedView ArticleGoogle Scholar
  4. Barratt BJ, Payne F, Lowe CE, Hermann R, Healy BC, Harold D, Concannon P, Gharani N, McCarthy MI, Olavesen MG, McCormack R, Guja C, Ionescu-Tirgoviste C, Undlien DE, Ronningen KS, Gillespie KM, Tuomilehto-Wolf E, Tuomilehto J, Bennett ST, Clayton DG, Cordell HJ, Todd JA: Remapping the insulin gene/IDDM2 locus in type 1 diabetes. Diabetes. 2004, 53: 1884-1889.PubMedView ArticleGoogle Scholar
  5. Nistico L, Buzzetti R, Pritchard LE, Van der Auwera B, Giovannini C, Bosi E, Larrad MT, Rios MS, Chow CC, Cockram CS, Jacobs K, Mijovic C, Bain SC, Barnett AH, Vandewalle CL, Schuit F, Gorus FK, Tosi R, Pozzilli P, Todd JA: The CTLA-4 gene region of chromosome 2q33 is linked to, and associated with, type 1 diabetes. Belgian Diabetes Registry. Hum Mol Genet. 1996, 5: 1075-1080. 10.1093/hmg/5.7.1075.PubMedView ArticleGoogle Scholar
  6. Ueda H, Howson JM, Esposito L, Heward J, Snook H, Chamberlain G, Rainbow DB, Hunter KM, Smith AN, Di Genova G, Herr MH, Dahlman I, Payne F, Smyth D, Lowe C, Twells RC, Howlett S, Healy B, Nutland S, Rance HE, Everett V, Smink LJ, Lam AC, Cordell HJ, Walker NM, Bordin C, Hulme J, Motzo C, Cucca F, Hess JF, Metzker ML, Rogers J, Gregory S, Allahabadia A, Nithiyananthan R, Tuomilehto-Wolf E, Tuomilehto J, Bingley P, Gillespie KM, Undlien DE, Ronningen KS, Guja C, Ionescu-Tirgoviste C, Savage DA, Maxwell AP, Carson DJ, Patterson CC, Franklyn JA, Clayton DG, Peterson LB, Wicker LS, Todd JA, Gough SC: Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease. Nature. 2003, 423: 506-511. 10.1038/nature01621.PubMedView ArticleGoogle Scholar
  7. Smyth D, Cooper JD, Collins JE, Heward JM, Franklyn JA, Howson JM, Vella A, Nutland S, Rance HE, Maier L, Barratt BJ, Guja C, Ionescu-Tirgoviste C, Savage DA, Dunger DB, Widmer B, Strachan DP, Ring SM, Walker N, Clayton DG, Twells RC, Gough SC, Todd JA: Replication of an association betweenthe lymphoid tyrosine phosphatase locus (LYP/PTPN22) with type 1 diabetes, and evidence for its role as a general autoimmunity locus. Diabetes. 2004, 53: 3020-3023.PubMedView ArticleGoogle Scholar
  8. Bottini N, Musumeci L, Alonso A, Rahmouni S, Nika K, Rostamkhani M, MacMurray J, Meloni GF, Lucarelli P, Pellecchia M, Eisenbarth GS, Comings D, Mustelin T: A functional variant of lymphoid tyrosine phosphatase is associated with type I diabetes. Nat Genet. 2004, 36: 337-338. 10.1038/ng1323.PubMedView ArticleGoogle Scholar
  9. Vella A, Cooper JD, Lowe CE, Walker N, Nutland S, Widmer B, Jones R, Ring SM, McArdle W, Pembrey ME, Strachan DP, Dunger DB, Twells RC, Clayton DG, Todd JA: Localization of a type 1 diabetes locus in the IL2RA/CD25 region by use of tag single-nucleotide polymorphisms. Am J Hum Genet. 2005, 76: 773-779. 10.1086/429843.PubMedPubMed CentralView ArticleGoogle Scholar
  10. Miwa T, Song WC: Membrane complement regulatory proteins: insight from animal studies and relevance to human diseases. Int Immunopharmacol. 2001, 1: 445-459. 10.1016/S1567-5769(00)00043-6.PubMedView ArticleGoogle Scholar
  11. Morgan BP: Regulation of the complement membrane attack pathway. Crit Rev Immunol. 1999, 19: 173-198.PubMedView ArticleGoogle Scholar
  12. Gasque P: Complement: a unique innate immune sensor for danger signals. Mol Immunol. 2004, 41: 1089-1098. 10.1016/j.molimm.2004.06.011.PubMedView ArticleGoogle Scholar
  13. Lublin DM: Review: Cromer and DAF: role in health and disease. Immunohematol. 2005, 21: 39-47.Google Scholar
  14. Lublin DM, Kompelli S, Storry JR, Reid ME: Molecular basis of Cromer blood group antigens. Transfusion. 2000, 40: 208-213. 10.1046/j.1537-2995.2000.40020208.x.PubMedView ArticleGoogle Scholar
  15. Storry JR, Reid ME: The Cromer blood group system: a review. Immunohematol. 2002, 18: 95-103.Google Scholar
  16. Hue-Roye K, Powell VI, Patel G, Lane D, Maguire M, Chung A, Reid ME: Novel molecular basis of an Inab phenotype. Immunohematol. 2005, 21: 53-55.Google Scholar
  17. Lin F, Spencer D, Hatala DA, Levine AD, Medof ME: Decay-accelerating factor deficiency increases susceptibility to dextran sulfate sodium-induced colitis: role for complement in inflammatorybowel disease. J Immunol. 2004, 172: 3836-3841.PubMedView ArticleGoogle Scholar
  18. Clayton A, Harris CL, Court J, Mason MD, Morgan BP: Antigen-presenting cell exosomes are protected from complement-mediated lysis by expression of CD55 and CD59. Eur J Immunol. 2003, 33: 522-531. 10.1002/immu.200310028.PubMedView ArticleGoogle Scholar
  19. Heeger PS, Lalli PN, Lin F, Valujskikh A, Liu J, Muqim N, Xu Y, Medof ME: Decay-accelerating factor modulates induction of T cell immunity. J Exp Med. 2005, 201: 1523-1530. 10.1084/jem.20041967.PubMedPubMed CentralView ArticleGoogle Scholar
  20. Liu J, Miwa T, Hilliard B, Chen Y, Lambris JD, Wells AD, Song WC: The complement inhibitory protein DAF (CD55) suppresses T cell immunity in vivo. J Exp Med. 2005, 201: 567-577. 10.1084/jem.20040863.PubMedPubMed CentralView ArticleGoogle Scholar
  21. Miwa T, Maldonado MA, Zhou L, Sun X, Luo HY, Cai D, Werth VP, Madaio MP, Eisenberg RA, Song WC: Deletion of decay-accelerating factor (CD55) exacerbates autoimmune disease development in MRL/lpr mice. Am J Pathol. 2002, 161: 1077-1086.PubMedPubMed CentralView ArticleGoogle Scholar
  22. Holers VM: The complement system as a therapeutic target in autoimmunity. Clin Immunol. 2003, 107: 140-151. 10.1016/S1521-6616(03)00034-2.PubMedView ArticleGoogle Scholar
  23. Concannon P, Erlich HA, Julier C, Morahan G, Nerup J, Pociot F, Todd JA, Rich SS: Type 1 diabetes: evidence for susceptibility Loci from four genome-wide linkage scans in 1,435 multiplex families. Diabetes. 2005, 54: 2995-3001.PubMedView ArticleGoogle Scholar
  24. Cox NJ, Wapelhorst B, Morrison VA, Johnson L, Pinchuk L, Spielman RS, Todd JA, Concannon P: Seven regions of the genome show evidence of linkage to type 1 diabetes in a consensus analysis of 767 multiplex families. Am J Hum Genet. 2001, 69: 820-830. 10.1086/323501.PubMedPubMed CentralView ArticleGoogle Scholar
  25. International HapMap Project. [http://www.hapmap.org]
  26. Altshuler D, Brooks LD, Chakravarti A, Collins FS, Daly MJ, Donnelly P: A haplotype map of the human genome. Nature. 2005, 437: 1299-1320. 10.1038/nature04226.View ArticleGoogle Scholar
  27. Wang WY, Todd JA: The usefulness of different density SNP maps for disease association studies of common variants. Hum Mol Genet. 2003, 12: 3145-3149. 10.1093/hmg/ddg337.PubMedView ArticleGoogle Scholar
  28. Chapman JM, Cooper JD, Todd JA, Clayton DG: Detecting disease associations due to linkage disequilibrium using haplotype tags: a class of tests and the determinants of statistical power. Hum Hered. 2003, 56: 18-31. 10.1159/000073729.PubMedView ArticleGoogle Scholar
  29. Clayton D, Chapman J, Cooper J: Use of unphased multilocus genotype data in indirect association studies. Genet Epidemiol. 2004, 27: 415-428. 10.1002/gepi.20032.PubMedView ArticleGoogle Scholar
  30. Clayton DG, Walker NM, Smyth DJ, Pask R, Cooper JD, Maier LM, Smink LJ, Lam AC, Ovington NR, Stevens HE, Nutland S, Howson JM, Faham M, Moorhead M, Jones HB, Falkowski M, Hardenbol P, Willis TD, Todd JA: Population structure, differential bias and genomic control in a large-scale, case-control association study. Nat Genet. 2005, 37: 1243-1246. 10.1038/ng1653.PubMedView ArticleGoogle Scholar
  31. Swarbrick MM, Vaisse C: Emerging trends in the search for genetic variants predisposing to human obesity. Curr Opin Clin Nutr Metab Care. 2003, 6: 369-375. 10.1097/00075197-200307000-00003.PubMedGoogle Scholar
  32. Fearnhead NS, Winney B, Bodmer WF: Rare variant hypothesis for multifactorial inheritance: susceptibility to colorectal adenomas as a model. Cell Cycle. 2005, 4: 521-525.PubMedView ArticleGoogle Scholar
  33. Storry JR, Sausais L, Hue-Roye K, Mudiwa F, Ferrer Z, Blajchman MA, Lublin DM, Ma BW, Miquel JF, Nervi F, Pereira J, Reid ME: GUTI: a new antigen in the Cromer blood group system. Transfusion. 2003, 43: 340-344. 10.1046/j.1537-2995.2003.00319.x.PubMedView ArticleGoogle Scholar
  34. Telen MJ, Rao N, Udani M, Thompson ES, Kaufman RM, Lublin DM: Molecular mapping of the Cromer blood group Cra and Tca epitopes of decay accelerating factor: toward the use of recombinant antigens in immunohematology. Blood. 1994, 84: 3205-3211.PubMedGoogle Scholar
  35. Daniels GL, Green CA, Darr FW, Anderson H, Sistonen P: A 'new' Cromer-related high frequency antigen probably antithetical to WES. Vox Sang. 1987, 53: 235-238.PubMedView ArticleGoogle Scholar
  36. Sistonen P, Nevanlinna HR, Virtaranta-Knowles K, Tuominen I, Pirkola A, Green CA, Tippett P: WES, a 'new' infrequent blood group antigen in Finns. Vox Sang. 1987, 52: 111-114.PubMedView ArticleGoogle Scholar
  37. Lindahl G, Sjobring U, Johnsson E: Human complement regulators:a major target for pathogenic microorganisms. Curr Opin Immunol. 2000, 12: 44-51. 10.1016/S0952-7915(99)00049-7.PubMedView ArticleGoogle Scholar
  38. Liszewski MK, Post TW, Atkinson JP: Membrane cofactor protein (MCP or CD46): newest member of the regulators of complement activation gene cluster. Annu Rev Immunol. 1991, 9: 431-455. 10.1146/annurev.iy.09.040191.002243.PubMedView ArticleGoogle Scholar
  39. Power C, Elliott J: Cohort profile: 1958 British birth cohort (National Child Development Study). Int J Epidemiol. 2006, 35: 34-41. 10.1093/ije/dyi183.PubMedView ArticleGoogle Scholar
  40. Bain SC, Todd JA, Barnett AH: The British Diabetic Association–Warren repository. Autoimmunity. 1990, 7: 83-85.PubMedView ArticleGoogle Scholar
  41. Lernmark A, Ducat L, Eisenbarth G, Ott J, Permutt MA, Rubenstein P, Spielman R: Family cell lines available for research. Am J Hum Genet. 1990, 47: 1028-1030.PubMedPubMed CentralGoogle Scholar
  42. Burren OS, Healy BC, Lam AC, Schuilenburg H, Dolman GE, Everett VH, Laneri D, Nutland S, Rance HE, Payne F, Smyth D, Lowe C, Barratt BJ, Twells RC, Rainbow DB, Wicker LS, Todd JA, Walker NM, Smink LJ: Development of an integrated genome informatics, data management and workflow infrastructure: a toolbox for the study of complex disease genetics. Hum Genomics. 2004, 1: 98-109.PubMedPubMed CentralView ArticleGoogle Scholar
  43. Smink LJ, Helton EM, Healy BC, Cavnor CC, Lam AC, Flamez D, Burren OS, Wang Y, Dolman GE, Burdick DB, Everett VH, Glusman G, Laneri D, Rowen L, Schuilenburg H, Walker NM, Mychaleckyj J, Wicker LS, Eizirik DL, Todd JA, Goodman N: T1DBase, a community web-based resource for type 1 diabetes research. Nucleic Acids Res. 2005, D544-549. 33 DatabaseGoogle Scholar
  44. Gbrowse. [http://www.gmod.org/]
  45. T1DBase. [http://t1dbase.org/cgi-bin/dispatcher.cgi/Welcome/display]
  46. Bonfield JK, Rada C, Staden R: Automated detection of point mutations using fluorescent sequence trace subtraction. Nucleic Acids Res. 1998, 26: 3404-3409. 10.1093/nar/26.14.3404.PubMedPubMed CentralView ArticleGoogle Scholar
  47. Lowe CE, Cooper JD, Chapman JM, Barratt BJ, Twells RC, Green EA, Savage DA, Guja C, Ionescu-Tirgoviste C, Tuomilehto-Wolf E, Tuomilehto J, Todd JA, Clayton DG: Cost-effective analysis of candidate genes using htSNPs: a staged approach. Genes Immun. 2004, 5: 301-305. 10.1038/sj.gene.6364064.PubMedView ArticleGoogle Scholar
  48. Ioannidis JP, Trikalinos TA, Ntzani EE, Contopoulos-Ioannidis DG: Genetic associations in large versus small studies: an empirical assessment. Lancet. 2003, 361: 567-571. 10.1016/S0140-6736(03)12516-0.PubMedView ArticleGoogle Scholar
  49. Service SK, Sandkuijl LA, Freimer NB: Cost-effectivedesigns for linkage disequilibrium mapping of complex traits. Am J Hum Genet. 2003, 72: 1213-1220. 10.1086/375165.PubMedPubMed CentralView ArticleGoogle Scholar
  50. JDRF/WT Diabetes and Inflammation Laboratory. [http://www-gene.cimr.cam.ac.uk/clayton/software/stata]
  51. Ranade K, Chang MS, Ting CT, Pei D, Hsiao CF, Oliver M, Pesich R, Hebert J, Chen YD, Dzau VJ, Curb D, Olshen R, Risch N, Cox DR, Botstein D: High -throught genotyping with single nucleotide polymorphisms. Genome Res. 2001, 11: 1262-1268.PubMedPubMed CentralGoogle Scholar

Copyright

© Taniguchi et al; licensee BioMed Central Ltd. 2006

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement