Insertion-deletion polymorphisms (indels) as genetic markers in natural populations

  • Ülo Väli1, 2,

    Affiliated with

    • Mikael Brandström1,

      Affiliated with

      • Malin Johansson1 and

        Affiliated with

        • Hans Ellegren1Email author

          Affiliated with

          BMC Genetics20089:8

          DOI: 10.1186/1471-2156-9-8

          Received: 29 September 2007

          Accepted: 22 January 2008

          Published: 22 January 2008

          Abstract

          Background

          We introduce the use of short insertion-deletion polymorphisms (indels) for genetic analysis of natural populations.

          Results

          Sequence reads from light shot-gun sequencing efforts of different dog breeds were aligned to the dog genome reference sequence and gaps corresponding to indels were identified. One hundred candidate markers (4-bp indels) were selected and genotyped in unrelated dogs (n = 7) and wolves (n = 18). Eighty-one and 76 out of 94 could be validated as polymorphic loci in the respective sample. Mean indel heterozygosity in a diverse set of wolves was 19%, and 74% of the loci had a minor allele frequency of >10%. Indels found to be polymorphic in wolves were subsequently genotyped in a highly bottlenecked Scandinavian wolf population. Fifty-one loci turned out to be polymorphic, showing their utility even in a population with low genetic diversity. In this population, individual heterozygosity measured at indel and microsatellite loci were highly correlated.

          Conclusion

          With an increasing amount of sequence information gathered from non-model organisms, we suggest that indels will come to form an important source of genetic markers, easy and cheap to genotype, for studies of natural populations.

          Background

          Advancement in population and evolutionary genetic research has been accompanied by – or perhaps better phrased – been a consequence of continuous improvement in the way genetic similarity or dissimilarity between genomes is assessed. Seen in long time perspective, genetic marker methodology has evolved from focusing on phenotypes, via immunological parameters and proteins, to genotypes. Following their introduction to the study of natural populations about 15 years ago [13], microsatellites or short simple tandem repeats have been the genotype-based marker approach of choice for many applications where the relatedness between individuals, populations or species is sought. Preceding and subsequently in parallel to this, non-repetitive DNA sequence variation has been assessed through various approaches, including DNA sequencing, restriction fragment length polymorphism (RFLP) analysis, single strand conformation polymorphism (SSCP) analysis, random amplified polymorphism detection (RAPD) and amplified fragment length polymorphism (AFLP) analysis [4]. More recently, single nucleotide polymorphisms (SNPs) are increasingly finding their application in studies of natural populations [5, 6].

          The benefits of microsatellites are several and well-known. They are multi-allelic, show high heterozygosity and are relatively easy to analyse at moderate cost. Because of the high polymorphism information content, a rather limited number of markers suffice for many applications in molecular ecology and population genetics. It is usually not too difficult to isolate the required markers from DNA libraries [7] or to employ markers originally developed for related species [8]. SNPs merit as genetic markers for other reasons. They are very common, with genomic densities outnumbering that of microsatellites by orders of magnitudes. Large numbers of individuals may be genotyped at large number of loci by simple and fast automatic methods, and data interpretation is usually straightforward [5, 9]. Moreover, SNP variation at protein-coding genes and in other functionally constrained regions of the genome is likely to form the main genetic background to phenotypic variation. Furthermore biallelic SNPs evolve in a manner well described by simple mutation models. There are good reasons to believe that they in many cases will gradually come to replace the use microsatellites in molecular ecology and population genetics/genomics research [6].

          Unfortunately, however useful, both microsatellites and SNPs suffer from some shortcomings. The complex and heterogenous mutation pattern of microsatellites [10] introduces ambiguities to further data analysis. Genotyping errors may occur because of stutter bands and technical artefacts (allelic dropouts, null alleles, false alleles, size homoplasy) [11]. As for SNPs, many more markers are needed to get the same amount of information [6, 9]. Moreover, despite the many elegant genotyping methods available [9], most of them are relatively costly at small or medium scales, and requires special equipment for high-throughput genotyping.

          With a few years' lag phase, the introduction of new genetic markers to the study of natural populations has generally followed methodological developments made in the genetic analysis of model organisms [4]. Currently, there is an increasing focus on polymorphisms of the type short insertions and deletions (indels) in genomic research of humans [12, 13] and model species such as Drosophila melanogaster [14] and chicken G. gallus [15]. Indels have been recognised as an abundant source of genetic markers that are widely spread across the genome, though not as common as SNPs. For instance, Mills et al. [13] used data from re-sequencing surveys to identify 415,436 indels segregating in human populations and they estimated that among the total number of >10 million polymorphisms known in humans, some 1.5 million represent indels. Clearly, this indicates that indels could form a very common class of genetic markers also in non-model species and this is particularly so given that genetic diversity in many natural populations typically seems to be higher than in humans [5, 6, 16]. Most importantly, indels can be genotyped with simple procedures based on size separation. Another advantage is the minuscule chance of two indel mutations of exactly the same length happening at the same genomic position, meaning that shared indels can confidently been seen as representing identity-by-descent [cf. [17]].

          In this study we present a test of the usefulness of indel markers in natural populations. We use a bioinformatics approach to survey dog shot-gun reads [18] for the presence of indels and based on this we design a pipeline for development of PCR-based indel markers. We subsequently genotype 100 indels in natural wolf populations and compare the results with data on microsatellite variability obtained from the same animals.

          Results

          There are ≈100,000 shot-gun reads available from each of 9 different dog breeds, sequences data that come in addition to data obtained for the partial [19] or full genome sequencing [18] of two dogs. We surveyed 200,000 of these trace reads for the occurrence of short insertion and deletion polymorphisms, as detected by alignment against the reference sequence of one female boxer [18]. Note that there is essentially no sequence overlap among trace reads so the alignments were consistently in the form of only two alleles drawn from the population of dogs. In total, this yielded 30,116 length polymorphisms, corresponding to about one length variant every 2400 bp. Consistent with what has been found in other organisms cf. [12, 13, 15, 20], the great majority of indels were very short with a dominance of 1-bp events (Table 1). From these polymorphism data we chose 4-bp indels for further analysis since they are easily scored by size separation and relatively abundant in the genome. We selected 100 4-bp non-repetitive indels located within unique sequence. They were spread across the canine genome and consistently represented autosomal loci; the great majority of them likely to reside in non-protein coding sequence. Of the 100, 94 could be readily amplified and scored and were selected for further analysis (Table 2).
          Table 1

          Number and density of indels found.

          Indel size (bp)

          Count

          Density (indels per million bp)

          1

          20558

          284.6

          2

          3352

          46.4

          3

          1942

          26.9

          4

          2185

          30.2

          5

          678

          9.4

          6

          436

          6.0

          7

          297

          4.1

          8

          297

          4.1

          9

          219

          3.0

          10

          152

          2.1

          Table 2

          Location of selected indel-markers (position on the respective chromosome in the dog genome assembly), primer sequences, amplicon length and expected heterozygosities from the genotyping of 18 wolves from worldwide.

          No.

          Chromosome

          Position

          Primer F

          Primer R

          Fragment length (bp)

          He

          1

          23

          35377868

          ccaggcttgtgtgaagctct

          gccttgttggtttcagtggt

          126

          0.43

          2

          21

          44954960

          tgtcatttggccagatctctaa

          ttggattaaccctaccacacg

          117

          0.26

          3

          5

          56432744

          catgctgcttgaagtgcaata

          tctctgtgtgcctctcatgaat

          123

          0.00

          4

          6

          31824728

          cacaatgaccacttattaaagattaca

          ctaggatgagagcccagctt

          139

          0.00

          5

          29

          17604384

          tgtcaggtttcatatccttttgtg

          gaactatccttaaatagaaccaatgc

          111

          0.29

          6

          15

          52623379

          ttcacatccatctgtcttgga

          acccgggagtttgcctatac

          125

          0.20

          7

          12

          4364137

          ctcctgttccctccagca

          ggaccatgctgtggatctg

          115

          0.17

          8

          30

          32665884

          agaccagggtctgaatttgc

          tttccaaggtcccaccacta

          116

          0.24

          9

          7

          52754426

          ttcacaaattgctatacctaaaaatg

          ttcctgtgggcataataatca

          136

          0.48

          10

          26

          32666193

          tccaagaacaaagaagtaatgtaaaa

          ggaattgatttactgatagtgagatg

          130

          0.39

          11

          37

          18098142

          gaaaggtccctctgaattgaa

          tctgtgctcttcactggaaaaa

          122

          0.18

          12

          14

          38060282

          gtgtgctctaggggccatt

          gaatgaaatcatggaagagcaa

          115

          0.30

          13

          17

          46184901

          gaagggacaaaaccttggaa

          tgaactaccctcgtgatcca

          139

          0.37

          14

          28

          38785954

          aaaggagggcttgcagtttt

          ttctccttttagaccctttgtca

          90

          0.32

          15

          25

          8846761

          tgccttagcgttggcatt

          tggtgctctttcttgttgga

          169

          0.36

          16

          34

          7543229

          caggagcaaagtaagggtaatca

          gctttggtattgttgattctattgtaa

          90

          0.44

          17

          20

          21505420

          aatggggacaccagtcactt

          tgggagttctggctccac

          139

          0.00

          18

          1

          32746664

          tcctgcggcagtttgg

          ccaagattgtgcatgtcagg

          104

          0.36

          19

          23

          42171234

          caaaggcaagaaggcagatg

          tacatggtccctgtgttcca

          81

          0.51

          20

          35

          25523850

          ttagcgatgttgagcgttttt

          ttcccttaagaaataggcagagg

          92

          Excluded

          21

          22

          41896467

          tgcaaaggagtgggaattatc

          tggatgttaaaaacctggtatattgt

          164

          0.37

          22

          30

          32665884

          ccaagccccttccaatacta

          tttccaaggtcccaccacta

          92

          0.29

          23

          10

          55417044

          tgctttgcatgttacattcttca

          catgtcatagtcacatgctgtacg

          151

          0.32

          24

          22

          20849044

          tattgctgccctgtttcaga

          gctgaaggaaatatctgttgaatg

          102

          0.16

          25

          24

          40849741

          ctgcggtctcacatccttag

          tgagggggatttgatctctt

          69

          0.14

          26

          31

          8148287

          tctgctcaggtttagccttg

          ggatgcaagaaaatctgctg

          80

          0.43

          27

          3

          67261495

          ttactcccagctctgtgcat

          gacccaggtggggatatcta

          88

          0.06

          28

          26

          37097342

          tgcccccactactcttgc

          aaagggtgatggtcctttga

          98

          0.09

          29

          1

          109880549

          tgttgagcccttgaaatgag

          agcgaaaagtggcagtgg

          68

          0.51

          30

          13

          20047698

          tggctgccccatcttatg

          cacaatggcagaacacgag

          78

          0.06

          31

          10

          13999933

          gccttcttcctctgcctct

          ctcaggcaggcaaataaaaa

          90

          0.13

          32

          5

          6092689

          gcttgggaaatcatggtca

          gctaaggaaagcaagctgga

          100

          0.50

          33

          3

          52499600

          tctgactggcctccttcg

          attcaagtgtgcccgagag

          67

          0.51

          34

          2

          87005110

          gccgccgtgtcttgtc

          cgaatgcgtgcttaccg

          80

          0.07

          35

          5

          16794632

          cgatgctggtgaggaagc

          ccatccctgagccacct

          91

          Excluded

          36

          1

          40637985

          aagggccgatgccagt

          caggttcttgtttccccaaa

          100

          0.42

          37

          14

          16593885

          cccaggtgccccttattt

          ggctcatgctgctctgg

          110

          0.00

          38

          38

          3128143

          gcttcccttgtttctttcca

          tgcccatgtaccaaatgaa

          121

          0.51

          39

          6

          78974466

          gtagggcaagcggcaag

          tgcttcctggacatttgga

          110

          0.14

          40

          4

          68490768

          ttgcttgggaacatggag

          gcccttgtcatccactagga

          121

          0.00

          41

          1

          41518626

          cctggtgcaggttgcag

          ccttcggagcccatgc

          106

          0.42

          42

          19

          29399024

          caggacacttgcaccagatt

          gagcagaggtgaggctgaa

          120

          0.00

          43

          12

          27463695

          cagtagccaaattgtggaagc

          accacgtagtcttgacccattc

          68

          0.30

          44

          16

          10834862

          gttcccttctcagaggacca

          caatgagtgaagggggtcag

          69

          0.00

          45

          14

          38539141

          gagtggcacacgagcactt

          gcaggactgtctggaggttg

          68

          0.31

          46

          8

          60840667

          tgcctgagggagctgtatatg

          tctcattgtggagcaaagacat

          75

          0.51

          47

          5

          36083663

          gctttgttgtaagcagcgata

          tgtgagaaactccattgcctta

          74

          0.21

          48

          7

          53313567

          agaaggggcagacttgagg

          tccctcatttcacaagctga

          75

          0.19

          49

          1

          88201810

          tggctcattgatttgtgattct

          ggccagctcttcttgttgag

          78

          0.00

          50

          14

          61925547

          gggttctctagggagatgacaa

          aggacccaagtggattctga

          83

          Excluded

          51

          7

          17212546

          gtcatggtgacatcgcagtt

          gcctcatgccaatgagagac

          85

          0.12

          52

          2

          67041786

          gatggccgattgtacatcaa

          tggttgcagggaagattagg

          95

          0.34

          53

          5

          3965764

          ccgtctagttgtcgggtgtt

          tgcagtatttagggtggagga

          94

          0.43

          54

          34

          24388648

          cccttgtaaaggggaggaga

          tggctctgaatttaggcattt

          94

          0.48

          55

          12

          23053279

          agctctcctgctgtgattttt

          tgcagacaaatggactgaaga

          98

          0.44

          56

          20

          29687857

          tgagcacgaagaggtagagaag

          tcaagtgcaagtcaccaaact

          100

          0.43

          57

          30

          37964459

          cgtgaatggtccaaaatgat

          catcagcatttccagagttctt

          100

          0.26

          58

          13

          42973844

          tttctgggcaaaaacagtga

          tttagatgggagggaatggtt

          108

          Excluded

          59

          5

          91665974

          accttctgtttcccctttgg

          agagcgcagcagagatgact

          103

          0.00

          60

          4

          43098715

          gtttacaccacccagcctga

          aggcagttacaggcattaatca

          109

          0.40

          61

          20

          40585796

          cccatccctgaggaagagag

          ggacacccgcatttctgtc

          114

          0.12

          62

          7

          8798933

          cccagaaaacaagagaaggaaa

          tgttggcagatctcatggtc

          114

          0.00

          63

          14

          23314695

          acccaccagattggctaaaa

          tcgaacaggtccagtttacatt

          116

          0.26

          64

          26

          35769409

          cctggcttaaccccttacct

          aaccgctatcccacattctg

          96

          0.00

          65

          4

          56495029

          tcccactgtagcttgaaaacg

          ttcaggtattgctgtccaaaaa

          95

          0.51

          66

          17

          19537687

          atgctttgcagagatgcttg

          tgctcatgtcagaacagagagg

          94

          0.31

          67

          31

          26928202

          atgaacaagcaccccaaaac

          cagtccacttcaatgcacca

          68

          0.27

          68

          10

          66801300

          ccccaaattaagggaagttca

          tccatgaccaaatctgcatc

          70

          0.12

          69

          10

          63275151

          tccagaacttggagagaatcaa

          tccaggcaagactatgagca

          70

          0.30

          70

          5

          58727403

          ctggaccacatatggcttga

          tgccggagagatacgtgtaa

          72

          0.00

          71

          5

          29583832

          ccacacagtgttgcctgtagt

          ggaaagcacagaaagttgtgaa

          73

          0.49

          72

          11

          25068367

          cccctgcttgtgctctctc

          ctctcagcaacccacagagat

          75

          0.49

          73

          19

          54304531

          aagccttgcacttgagcttg

          ccattggaaaggcacgtact

          77

          0.27

          74

          30

          39573069

          gcttttgtcatgaaacaccaa

          ccaccagatgctcaagtctg

          79

          0.48

          75

          19

          55236292

          gcccacagggtctttattttt

          gcttgggtctcttcctctctc

          78

          0.33

          76

          3

          53761240

          ctgtggtgcagcggtttag

          ggagcctgacatgggactt

          78

          0.00

          77

          4

          90768017

          gttctccctgtgtctgactgtt

          aaagaccaaggggtgaaaga

          84

          0.13

          78

          11

          57430384

          agggacagacccactaagtgtc

          tccttaggcgacatggagac

          86

          Excluded

          79

          36

          32128918

          tgatatagccgaagtcaggaag

          aatggaaagatcatccagacag

          89

          0.40

          80

          14

          49479392

          tttcaaattgctgaatgttgg

          ccctggtctccaggatcac

          89

          0.47

          81

          27

          13108059

          cagccaattggacacaaaaa

          aaaatcaagatgtcagcagagg

          88

          0.00

          82

          6

          61627505

          gtcatgatcccatggtccta

          gtagaggggcagagggagag

          88

          0.00

          83

          36

          14699428

          gtgttttcttttgggcaagg

          tgcaaccaacacacagatga

          92

          0.49

          84

          32

          36108071

          cccagtgttggtcacatataca

          gcgatgaaaattgggaaaga

          96

          Excluded

          85

          17

          57586353

          gtgattagggttgaggggaga

          ttttccatcaaggtttgtcca

          97

          0.42

          86

          5

          16750608

          aattttccaggaggctttgg

          ttccctcctgctgatctagg

          98

          0.06

          87

          19

          43306776

          tggggtaaatcagtgagtgaag

          ggcattaagagaagcctgctg

          99

          0.07

          88

          29

          43945653

          aacccgaataacattaggagga

          tgggtttaagctggttacgg

          104

          0.51

          89

          5

          31951980

          cccagaaatccacttaatgacc

          tgtgttaccagggctaggttc

          104

          0.44

          90

          7

          50783779

          ggttagcttagctcctctccaa

          agccacatgctgaaaggaag

          104

          0.00

          91

          31

          10957463

          ttggcaactgccttacaataaa

          ttgaatgtggacatgaaacaaa

          106

          0.47

          92

          16

          6629437

          gaaatgggaaggttttattcca

          ggtgctgacaacagaaaacct

          109

          0.46

          93

          5

          75136583

          aggacacagacagatgtgagga

          ccgaagaggaatctgcactc

          111

          0.00

          94

          3

          89213750

          gagaacttcgatgtgagggaat

          ctctcccaccaaaaatctcct

          113

          0.29

          95

          21

          51457175

          aggcattcagggtgttaaaaa

          tggtgaactggaaagtagctga

          108

          0.51

          96

          12

          53379600

          ttcccaaggagttggagaga

          gctgagggcagctgtgttat

          68

          0.00

          97

          14

          58723304

          ccctgtggtaaccatcaacc

          caaagtgaacaagcaaagcaa

          67

          0.51

          98

          3

          11002853

          ccactggccctaagtgactg

          ttagggttttaaaggctgtgc

          70

          0.06

          99

          30

          30015918

          tcaggttttggatttgaagga

          taagcacaaccattagctcca

          72

          0.06

          100

          7

          65831405

          gaggttcaaatttcccatatcc

          gggatccatgcaaaatagttc

          73

          0.37

          Using conventional genotyping based on fragment length separation in a DNA sequencing instrument, 81 out of the 94 putative markers were found to be polymorphic in a screening of 7 dogs and 76 of them were polymorphic in a global sample of 18 wolves (Figure 1A). As PCR primers were designed to generate amplicons of varying size within the 70-120-bp interval, combinations of multiplex reactions (three markers per PCR) were readily formed. This allowed simultaneous amplification, and consequently simultaneous genotyping within a single capillary, of several markers even using the same fluorofore (Figure 1B).
          http://static-content.springer.com/image/art%3A10.1186%2F1471-2156-9-8/MediaObjects/12863_2007_Article_574_Fig1_HTML.jpg
          Figure 1

          (a) Genotyping of a 4-bp indel locus in wolves showing (upper panel) a homozygote for the longer allele, (mid panel) a heterozygote and (lower panel) a homozygote for the shorter allele. (b) Multiplex amplification and simultaneous genotyping in a single capillary of five indel markers in one individual heterozygous for all these markers. The long and short alleles of marker 1–5 are labelled. All markers show some form of extra fragments that likely represent PCR artefacts. These may either be shorter (marker 2) or longer (marker 3–5) than the amplified allele, alternatively both shorter and longer (marker 1).

          In wolves, 74% of the polymorphic loci had a minor allele frequency of >10% and 49% of >20%. The average observed and expected heterozygosities were respectively 19.4% and 26.1% in wolves, while they were 26.8% and 35.5% in dogs. The distribution of wolf heterozygosities is shown in Figure 2.
          http://static-content.springer.com/image/art%3A10.1186%2F1471-2156-9-8/MediaObjects/12863_2007_Article_574_Fig2_HTML.jpg
          Figure 2

          Distribution of observed heterosygosities at 94 indel loci genotyped in 18 wolves from five populations worldwide.

          The 76 indels found to be polymorphic in the global sample of wolves were subsequently genotyped in 27 wolves from a Swedish population. Fifty-one loci were polymorphic and showed an observed mean heterozygosity of 25.3%, or 17.0% if including all 76 markers. The same wolves were also genotyped for a set of 20 microsatellites known to be informative in this population [e.g. [21]]. Expected heterozygosities for these loci ranged between 28–75%. There was a positive correlation between mean heterozygosity at indel and microsatellite loci in individual wolves (r 2 = 0.41, P < 0.001; Figure 3).
          http://static-content.springer.com/image/art%3A10.1186%2F1471-2156-9-8/MediaObjects/12863_2007_Article_574_Fig3_HTML.jpg
          Figure 3

          Correlation between average observed individual indel (51) and microsatellite (20) heterozygosities in 22 Swedish wolves.

          Discussion

          Our study shows the feasibility of using large-scale genomic sequence data for extracting putative insertion and deletion polymorphisms, marker loci subsequently can be validated to represent informative genetic markers at a population level. It also demonstrates the feasibility of transfer of genomic data from a model species to a natural population of a close relative. Dogs were domesticated from wolves 10,000–100,000 years ago [2224], and their divergence has since then been accentuated by strong artificial selection during domestication. Finally, by genotyping of indels and microsatellites in the same wolves it also shows that polymorphism levels of the two marker types are highly correlated.

          A lack of large-scale genome sequence information has up till now hampered the introduction of indels as genetic markers in non-model species. It can be anticipated that this will come to change in the near future. There is a rapid increase in the number of genome sequencing initiatives and new sequencing technology, like "454-sequencing" [25], offers immense possibilities for generating massive amount of sequence data from hitherto uncharacterised genomes. Importantly, the depth of sequence coverage provided by new technology means that it is well suited for sequence analysis of pools of individuals, from which a wealth of polymorphism data can be obtained [26]. For example, if 100 Mb of sequence is generated from each of two individuals (with a 1 Gb-genome) in two mega-sequencing runs, and with an indel density of 1 every 2 kb in pairwise comparisons, several hundred indels are expected to be detected.

          Indel density has not been as well characterized in natural populations as nucleotide diversity. In domestic chicken, the pairwise heterozygosity for indels is 2 × 10-4 per bp [15]. In a natural population of collared flycatchers, Backström et al. [27] found a similar occurrence of indels, 1–2 × 10-4 per bp. In this study we found about 30,000 indels in 7.2 Mbp of dog sequence, which translates into a heterozygosity of 4 × 10-4 per bp. This includes length variants in unique sequence as well as in repetititve DNA, like microsatellites. Using a similar search algorithm and a similar type of shot-gun vs. genomic reference data set for chicken, we recently found that about half of all length variants detected in this way represent tandem repeats [15]. This would suggest that in dogs, the heterozygosity for short non-repetitive indels is about 2 × 10-4 per bp, similar to chicken. Moreover, the length distribution of dog indels (Table 1) show congruence with such data from chicken.

          The Swedish wolf population was functionally extinct by the 1960s–1970s but has subsequently recovered to a current size of well over 100 individuals [28]. All contemporary Scandinavian wolves are thought to originate from only three founders, that were eastern immigrants arriving to Sweden around 1980 and 1990, respectively [21]. The strong bottleneck, subsequent inbreeding and the associated loss of genetic diversity experienced by this population [21, 29], give the opportunity to test the utility of indel markers in a small and endangered natural population. The finding that about 50% of in silico predicted indels from pairwise sequence comparisons of dog alleles is informative in this wolf population confirms the usefulness of indel markers even in a population with limited genetic diversity.

          The mean heterozygosity of the 51 polymorphic indels within the Scandinavian wolf population (25%) is somewhat lower than what was been observed for 21 SNPs (34%) in the same population [29]. However, those SNPs were initially identified from a screening of a limited number of Scandinavian wolves so there was an ascertainment bias in favour of markers with high polymorphism information content. Generally, for those indels and SNPs that represent neutral markers, there should be no reason to believe that heterozygosity for polymorphic loci differs between the two marker categories. Indels in coding sequence are likely to more often be deleterious than point mutations, at least indels that cause frame shift mutations, which should act as to reduce their diversity due to negative selection. On the other hand, point mutations in coding sequence may potentially more often than indels be subject to positive selection, which also reduces diversity. In any case, although probably comparable to SNPs, indels do show less variation than microsatellites. Thus, to obtain the same resolution power in relatedness analyses, a higher number of biallelic markers are needed compared to multiallelic microsatellites [3032]. However, the rich abundance of indels in genome sequence surveys and the ease by which they are genotyped (Figure 1a) and multiplexed (Figure 1b) add to their benefit. Moreover, it is possible to design microarrays specifically for short indels, by which genotyping costs become very low [32].

          Conclusion

          With an increasing amount of sequence information gathered from non-model organisms, we suggest that indels will come to form an important source of genetic markers, easy and cheap to genotype, for studies of natural populations.

          Methods

          Samples

          Genomic DNA was extracted from wolf tissue samples using standard phenol-chloroform extraction protocols or the DNEasy Tissue Kit (Qiagen). Altogether 18 samples, from Sweden (5), Finland (3), Spain (3), Russia (2) and Canada (5), were used to test the amplification ability and to get a first idea of polymorphism of indels. Seven domestic dog samples from different breeds (Dachshund, Dalmatian, Gordon Setter, Greenland Dog, Lakeland Terrier, Pyrenean Mountain Dog, Welsh Corgi) were also added. Subsequently, we tested the ability of indel markers to analyse the genetic diversity at the intra-populational level using tissue samples of 27 wolves collected between 1985 and 2005 from roadkills or shot animals from Sweden [21, 29].

          Selection of markers

          A total of about 200,000 dog trace read sequences were obtained from GenBank. These sequence tags were almost exclusively derived from light shot-gun sequencing of unrelated dogs that was done in conjunction to the sequencing of the dog genome [18]. An automated pipeline was set up to survey the sequences for potential indels and for design of primers. The initial step in the pipeline was to place all STS sequences onto the dog genome. This was done using local NCBI BLAST [33], with a conservative setting to require an E value of less than 10-70. To avoid possible duplicated loci all cases where there was more than one BLAST hit were discarded. Next, the BLAST results were surveyed for 4 bp indels, recognised as 4 bp gaps in alignments of shot-gun reads and the genome reference sequence. To avoid selection of microsatellites only those 4 bp indels where none of the flanks were identical to the indel were used for further processing. For each indel with at least 70 bp flanking sequence on both sides, Primer3 [34] was used for primer design. Primers were requested from the program for fragment lengths between 70 and 120 bp. The primers were constrained by a required melting temperature between 58 and 62°C, as well as a primer length between 19 and 22 bp. Finally the primers were evaluated with regard to self complementarity, as well as for the possibility of the resulting product to form a hair-pin. This was done through a simple complementarity testing procedure where possible self-complementarity at the sharp end of the hairpin was scored higher, and decreasing score inwards. The top 100 loci passing through all steps were picked for screening. Primers were fluorescently labelled with either FAM, HEX, or TET.

          The same animals were also genotyped for a set of 20 autosomal microsatellites, as described in ref. 20: c2001, c2006, c2010, c2017, c2054, c2079, c2088 and c2096, vWF, u109, u173, u225, u250 and u253 and PEZ01, PEZ03, PEZ05, PEZ06, PEZ08 and PEZ12.

          Genotyping and data analysis

          Amplification by polymerase chain reaction (PCR) was performed in 10 μl solution containing 20 ng DNA, 0.25 U AmpliTaq Gold polymerase with 1× Amplitaq Gold PCR buffer (Applied Biosystems), 2.5 mM MgCl2, 0.3 μM of each primer and 0.4 mM dNTP. The PCR profile for the indel markers included initial heating at 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 58°C for 30 s and 72°C for 1 min, and a final extension at 72°C for 10 min. The profile for microsatellites included an initial denaturation step of 95°C for 10 min, 11 touch-down cycles with 94°C for 30 s, 58°C for 30 s, decreasing by 0.5°C in each cycle, and 72°C for 1 min, then 28 cycles of 94°C for 30 s, 52°C for 30 s and 72°C for 1 min and a final extension of 72°C for 10 min. PCR products were run on a MegaBACE 1000 capillary sequencer (Amersham Biosciences) and analyzed using the accompanied software Genetic Profiler 2.2. Observed and expected heterosygosities calculated using Microsatellite Toolkit for MS Excel [35], and correlation between the observed individual heterozygosities according to indel and microsatellite data was estimated.

          Declarations

          Acknowledgements

          We thank Annika Einarsson for technical assistance, Jennifer Leonard and Carles Vilà for wolf samples, and two anonymous reviewers for useful comments on the manuscript. Financial support was obtained from the Norwegian and Swedish Natural Environmental Protection Agencies. ÜV was supported by the fellowship of the Visby programme from the Swedish Institute.

          Authors’ Affiliations

          (1)
          Department of Evolutionary Biology, Evolutionary Biology Centre, Uppsala University
          (2)
          Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences

          References

          1. Schlotterer C, Amos B, Tautz D: Conservation of polymorphic simple sequence loci in Cetacean species. Nature 1991,354(6348): 63–65.View ArticlePubMed
          2. Ellegren H: DNA typing of museum birds. Nature 1991,354(6349): 113–113.View ArticlePubMed
          3. Ellegren H: Polymerase-chain-reaction (PCR) analysis of microsatellites - a new approach to studies of genetic relationships in birds. Auk 1992,109(4): 886–895.
          4. Schlotterer C: The evolution of molecular markers - just a matter of fashion? Nature Reviews Genetics 2004,5(1): 63–69.View ArticlePubMed
          5. Brumfield RT, Beerli P, Nickerson DA, Edwards SV: The utility of single nucleotide polymorphisms in inferences of population history. Trends in Ecology & Evolution 2003,18(5): 249–256.View Article
          6. Morin PA, Luikart G, Wayne RK, SNP workshop group: SNPs in ecology, evolution and conservation. Trends in Ecology & Evolution 2004,19(4): 208–216.View Article
          7. Zane L, Bargelloni L, Patarnello T: Strategies for microsatellite isolation: A review. Molecular Ecology 2002,11(1): 1–16.View ArticlePubMed
          8. Primmer CR, Moller AP, Ellegren H: A wide-range survey of cross-species microsatellite amplification in birds. Molecular Ecology 1996,5(3): 365–378.PubMed
          9. Syvänen AC: Accessing genetic variation: Genotyping single nucleotide polymorphisms. Nature Reviews Genetics 2001,2(12): 930–942.View ArticlePubMed
          10. Ellegren H: Microsatellites: Simple sequences with complex evolution. Nature Reviews Genetics 2004,5(6): 435–445.View ArticlePubMed
          11. Pompanon F, Bonin A, Bellemain E, Taberlet P: Genotyping errors: Causes, consequences and solutions. Nature Reviews Genetics 2005,6(11): 847–859.View ArticlePubMed
          12. Bhangale TR, Rieder MJ, Livingston RJ, Nickerson DA: Comprehensive identification and characterization of diallelic insertion-deletion polymorphisms in 330 human candidate genes. Human Molecular Genetics 2005,14(1): 59–69.View ArticlePubMed
          13. Mills RE, Luttig CT, Larkins CE, Beauchamp A, Tsui C, Pittard WS, Devine SE: An initial map of insertion and deletion (INDEL) variation in the human genome. Genome Research 2006,16(9): 1182–1190.View ArticlePubMed
          14. Ometto L, Stephan W, De Lorenzo D: Insertion/deletion and nucleotide polymorphism data reveal constraints in Drosophila melanogaster introns and intergenic regions. Genetics 2005,169(3): 1521–1527.View ArticlePubMed
          15. Brandström M, Ellegren H: The genomic landscape of short insertion and deletion polymorphisms in the chicken (Gallus gallus) genome: a high frequency of deletions in tandem duplicates. Genetics 2007,176(3): 1691–1701.View ArticlePubMed
          16. Ellegren H: Molecular evolutionary genomics of birds. Cytogenet Genome Res 2007,117(1–4): 120–130.View ArticlePubMed
          17. Shedlock AM, Okada N: SINE insertions: Powerful tools for molecular systematics. Bioessays 2000,22(2): 148–160.View ArticlePubMed
          18. Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB, Kamal M, Clamp M, Chang JL, Kulbokas EJ, Zody MC, Mauceli E, Xie XH, Breen M, Wayne RK, Ostrander EA, Ponting CP, Galibert F, Smith DR, deJong PJ, Kirkness E, Alvarez P, Biagi T, Brockman W, Butler J, Chin CW, Cook A, Cuff J, Daly MJ, DeCaprio D, Gnerre S, Grabherr M, Kellis M, Kleber M, Bardeleben C, Goodstadt L, Heger A, Hitte C, Kim L, Koepfli KP, Parker HG, Pollinger JP, Searle SMJ, Sutter NB, Thomas R, Webber C, Lander ES, Plat BIGS: Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature 2005,438(7069): 803–819.View ArticlePubMed
          19. Kirkness EF, Bafna V, Halpern AL, Levy S, Remington K, Rusch DB, Delcher AL, Pop M, Wang W, Fraser CM, Venter JC: The dog genome: Survey sequencing and comparative analysis. Science 2003,301(5641): 1898–1903.View ArticlePubMed
          20. Brandström M, Ellegren H: The genomic landscape of short insertion and deletion polymorphisms in the chicken (Gallus gallus) genome: A high frequency of deletions in tandem duplicates. Genetics 2007,176(3): 1691–1701.View ArticlePubMed
          21. Vilà C, Sundqvist AK, Flagstad O, Seddon J, Bjornerfeldt S, Kojola I, Casulli A, Sand H, Wabakken P, Ellegren H: Rescue of a severely bottlenecked wolf (Canis lupus) population by a single immigrant. Proceedings of the Royal Society of London Series B-Biological Sciences 2003,270(1510): 91–97.View Article
          22. Leonard JA, Wayne RK, Wheeler J, Valadez R, Guillen S, Vila C: Ancient DNA evidence for Old World origin of New World dogs. Science 2002,298(5598): 1613–1616.View ArticlePubMed
          23. Savolainen P, Zhang YP, Luo J, Lundeberg J, Leitner T: Genetic evidence for an East Asian origin of domestic dogs. Science 2002,298(5598): 1610–1613.View ArticlePubMed
          24. Vilà C, Savolainen P, Maldonado JE, Amorim IR, Rice JE, Honeycutt RL, Crandall KA, Lundeberg J, Wayne RK: Multiple and ancient origins of the domestic dog. Science 1997,276(5319): 1687–1689.View ArticlePubMed
          25. Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J, Braverman MS, Chen YJ, Chen ZT, Dewell SB, Du L, Fierro JM, Gomes XV, Godwin BC, He W, Helgesen S, Ho CH, Irzyk GP, Jando SC, Alenquer MLI, Jarvie TP, Jirage KB, Kim JB, Knight JR, Lanza JR, Leamon JH, Lefkowitz SM, Lei M, Li J, Lohman KL, Lu H, Makhijani VB, McDade KE, McKenna MP, Myers EW, Nickerson E, Nobile JR, Plant R, Puc BP, Ronan MT, Roth GT, Sarkis GJ, Simons JF, Simpson JW, Srinivasan M, Tartaro KR, Tomasz A, Vogt KA, Volkmer GA, Wang SH, Wang Y, Weiner MP, Yu PG, Begley RF, Rothberg JM: Genome sequencing in microfabricated high-density picolitre reactors. Nature 2005,437(7057): 376–380.PubMed
          26. Barbazuk WB, Emrich SJ, Chen HD, Li L, Schnable PS: SNP discovery via 454 transcriptome sequencing. Plant Journal 2007, 51: 910–918.View ArticlePubMed
          27. Backström N, Fagerberg S, Ellegren H: Genomics of natural bird populations: a gene-based set of reference markers evenly spread across the avian genome. Molecular Ecology 2007, 17: 964–980.View ArticlePubMed
          28. Wabakken P, Sand H, Liberg O, Bjarvall A: The recovery, distribution, and population dynamics of wolves on the Scandinavian peninsula, 1978–1998. Canadian Journal of Zoology-Revue Canadienne De Zoologie 2001,79(4): 710–725.View Article
          29. Seddon JM, Parker HG, Ostrander EA, Ellegren H: SNPs in ecological and conservation studies: A test in the Scandinavian wolf population. Molecular Ecology 2005,14(2): 503–511.View ArticlePubMed
          30. Anderson EC, Garza JC: The power of single-nucleotide polymorphisms for large-scale parentage inference. Genetics 2006,172(4): 2567–2582.View ArticlePubMed
          31. Glaubitz JC, Rhodes OE, Dewoody JA: Prospects for inferring pairwise relationships with single nucleotide polymorphisms. Molecular Ecology 2003,12(4): 1039–1047.View ArticlePubMed
          32. Salathia N, Lee HN, Sangster TA, Morneau K, Landry CR, Schellenberg K, Behere AS, Gunderson KL, Cavalieri D, Jander G, Queitsch C: Indel arrays: An affordable alternative for genotyping. Plant J 2007,51(4): 727–737.View ArticlePubMed
          33. Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Research 1997,25(17): 3389–3402.View ArticlePubMed
          34. Rozen S, Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology 2000, 132: 365–386.PubMed
          35. Park SDE: Trypanotolerance in West African cattle and the population genetic effects of selection. PhD thesis, University of Dublin,http://​acer.​gen.​tcd.​ie/​~sdepark/​ms-toolkit/​index.​php 2001.

          Copyright

          © Väli et al. 2008

          This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

          Advertisement