Skip to main content

Table 1 The oligonucleotide sequence of primers used in PCR

From: Sp1 and KLF15 regulate basal transcription of the human LRP5 gene

Name Sequence(5'→3') Strand Location
LRP5F GCCTGACTGAGGAGCTGAAG sense -2381 ~ -2361
LRP5R GCTGCCTCCATGTTGTCC antisense + 105 ~ +125
LRP5R/HindIII CCCAAGCTT GCTGCCTCCATGTTGTCC antisense +105 ~ +125
-1901 F/KpnI GACGGTACC AGCTACGATCACACCACTAC Sense -1901 ~ -1881
-1594 F/KpnI GACGGTACC GGCTGCCATGAGATCAGGTG Sense -1594 ~ -1574
-1442 F/KpnI GACGGTACC AGGCTGTGCTGGTAGAGCTG sense -1442 ~ -1422
-1309 F/KpnI GACGGTACC CTGTACCTTCTACCACCAGC Sense -1309 ~ -1279
-1167 F/KpnI GACGGTACC TTGGTAGCAGCTCAAGTGTC Sense -1167 ~ -1147
-1085 F/KpnI GACGGTACC TTCTTCATGGCCTGTCAATG Sense -1085 ~ -1065
-953 F/KpnI GACGGTACC AATCTGGAGGAACACACACG Sense -953 ~ -933
-359 F/KpnI GACGGTACC TGAAACTGCCTCGCTGTGTG Sense -359 ~ -339
-219 F/KpnI GACGGTACC GCCAAGCCTCCCGGAGGCAC Sense -219 ~ -199
-167 F/KpnI GACGGTACC CCGCGGGGACCTGCGCCGCT Sense -167 ~ -147
-72 F/MluI CGACGCGT GGCGGCGGGGGGCGGAGAAG Sense -72 ~ -52
-53 F/MluI CGACGCGT GCGGCGCGGCTTCCGCTCCCG Sense -53 ~ -33
-40 F/KpnI GACGGTACC CGCTCCCGCGCGCCCAGCTC Sense -40 ~ -20
-72MT1/MluI CGACGCGT GGCGGCTTT GGGCGGAGAAG Sense -72 ~ -52
-72MT2/MluI CGACGCGT GGCGGCGGGGGGTT GAGAAGCGGCG Sense -72 ~ -52
-72MT12/MluI CGACGCGT GGCGGCTTT GGGTT GAGAAGCGGCG Sense -72 ~ -52
  1. Location: Nucleotide positions relative to the transcription start site (+1) of the human LRP5 gene.
  2. Restriction sites are indicated in bold. The nucleotides of specific mutagenesis are indicated in italic and bold.