Skip to main content

Advertisement

Table 2 List of primers used for amplification of mtDNA and primer extension reactions

From: Mitochondrial haplogroup U is associated with a reduced risk to develop exfoliation glaucoma in the German population

Reaction Primer sequence Nucleotide position
LD PCR forward: ACAACCCTTCGCTGACGCCATA -
  reverse: GGTGGTACCCAAATCTGCTTCC -
MPE R1 AGCCATCGCTGTAGTATA 14470
  ACCTGAGTAGGCCTAGAAATAAACAT 4580
  (A)8CTACACGACACGTACTACGTTGTAGC 7028
  (A)12GTTTATTACTCTTTTTTGAATGTTGTCAAA 10034
  (A)23CGACTCATTAAATTATGATAATCATAT 10463
  (A)27TACTCAAATGGGCCTGTCCTTGTAGTATAAA 15904
MPE R2 TGACCCCAATACGCAAAA 14766
  (A)5TCCATTGGTCTTAGGCCCCAA 12308
  (A)12TGTTAGCGGTTAGGCGTACGGC 8994
  (A)17GTGACTACAAAAAGGATTAGACTGA 10398
  (A)16CTTCCTACCACTCACCCTAGCATTACTTATATGA 4216
  (A)28GGCCACCTACTCATGCACCTAATTGGAAGC 9055
  1. LD, long distance; MPE R, multiplex primer extension reaction. Nucleotide position according to the revised Cambridge reference sequence (GenBank: J01415.2).