Skip to main content

Table 1 PCR primers (Sigma Aldrich, Castle Hill, Australia)

From: Gene cassette transcription in a large integron-associated array

Name, Binding site Sequence Usage
YB3 6FAM DAT722 attC rev GAATCMCTCTTRARYDSTTTGT attC PCR
YB4 6FAM DAT722 attC fwd TCACMCCTTARYDSGGCGTTA attC PCR,
Promoter isolation
MazG f Cassette 21 ORF fwd GTTATCTGAGTTACAAAGTC Method validation, Promoter isolation
MazG r Cassette 21 ORF rev TCCTATCGGTTGTACTTAAC Method validation, Promoter isolation
VhC 21f Cassette 21 ORF fwd TATGCGCCAGAGCAATCTGAACACTAT Promoter isolation
VhC 21r Cassette 21 ORF rev CCGTGAATATTGGCTAGAGCACAAACA Promoter isolation
VhC 89f Cassette 89 ORF fwd ATCAGAAATTGAAGACTTGC Method validation
VhC 89r Cassette 89 ORF rev TGAGACATTACGCAGTTAAA Method validation
VhC16f Cassette 16 ORF fwd AAAAGTCGCTCAGAAGAATA Promoter isolation
VhC16r Cassette 16 ORF rev GCATTACGGATACTTGTCTT Promoter isolation
VhC17f Cassette 17 ORF fwd ACTGGTCAAAATACAACCAT Promoter isolation
VhC17r Cassette 17 ORF rev TACAACATCGAGCTAACAAA Promoter isolation
VhC18f Cassette 18 ORF fwd GGTTTGATAGTTACGCTGAT Promoter isolation
VhC18r Cassette 18 ORF rev CAACCAAATGTGATAATGAA Promoter isolation
VhC19f Cassette 19 ORF fwd GAGTGCAGCAGGTTATTTAT Promoter isolation
VhC19r Cassette 19 ORF rev ATACTGACCGATAACTTTGG Promoter isolation