Skip to main content


Table 2 Summary of the genes surveyed and the primer sequences used in the study.

From: Population genetics of foxtail millet and its wild ancestor

Gene Name Rice/Millet Putative function Primers
DACP LOC_Os01g21160.2/EC612491 Dhydrolipoyllysine-residue acetyltransferase F:5-3'ACACTTTCCTTCCGTTCCTCAT
SIGT LOC_Os01g09120.2/EC613421 Signal transducer/two-component sensor molecule F:5-3' ATCCCAGCACTCAGTTCTTCAT
ADTY LOC_Os02g56550.1/EC612081 ATP-dependent transporter YFL028C F:5'-3' TCCACTACAAGGCGATTTCT
PP2C LOC_Os03g60650.1/EC612551 Catalytic/protein phosphatase type 2C F:5'-3' TGTGAAGGGCTCGCTTAAG
SPS1 LOC_Os08g20660.2/EC612114 Sucrose-phosphate synthase 1 F:5-3' TTGGCTTCTCGCTCACAGG
UPL LOC_Os10g41360.1/EC611973 Ubiquitin-protein ligase F:5-3' AGTGGTGCTGAGATTGGTAGA
TIFIIF LOC_Os10g10990.3/EC613446 Transcription initiation factor IIF, alpha subunit F:5-3' TCTTCTTGCTGTGGCTCCAG
TRAN LOC_Os11g37980.1/EC612732 Transferase, transferring glycosyl groups F:5-3' TATGAAGGGTAAAGTAATTGCTGC
MDEH LOC_Os12g43630.1/EC613245 Malate dehydrogenase, glyoxysomal precursor F:5-3' CTTGGGCCATTGAATGAGTT