Table 2 Primers for two-tailed test on the candidate QTL region of chromosome Z
From: Genetic effects of polymorphisms in candidate genes and the QTL region on chicken age at first egg
Primer | Primers sequences (5' →3') | Location1 (nt)/Sites | Length2 (bp) | AT3 (°C) | Restricton enzyme |
|---|---|---|---|---|---|
M9 | pyrosequencing | A32173403T | / | / | / |
M10 | F:aggagctgggtgacattgtg R:tggggtaaggacagcacagt | T32742394C | 721 | 58 | Msp I |
M11 | F:aggagctgggtgacattgtg R:tggggtaaggacagcacagt | T32742468C | 721 | 58 | PauI |
M12 | F:tgcaagcccaggaatcatcactc R:taaaactcttctttccttctaca | G32742603A | 294 | 58 | Alu I |
M13 | F:tcttcgaacacattactcactga R:ggcgttttgtgttttcttggcat | C33379782T (rs14761596) | 400 | 57 | Alu I |
M14 | pyrosequencing | G33610060A (rs14761431) | / | / | / |
M15 | pyrosequencing | (ATT)7 33729521(ATT)5 (rs16765989) | / | / | / |
M16 | pyrosequencing | C33832610T (rs14761267) | / | / | / |
M17 | pyrosequencing | G33962646T (rs16765930) | / | / | / |
M18 | pyrosequencing | C34050133T (rs14761127) | / | / | / |
M19 | pyrosequencing | C34163373T (rs16767050) | / | / | / |
M20 | pyrosequencing | G34263878A | / | / | / |