Skip to main content

Advertisement

Table 1 Name, pre-amplification forward and reverse primers, extension primers and nucleotide calls for the 45 SNP loci used in this study

From: Interpopulation hybridization results in widespread viability selection across the genome in Tigriopus californicus

Name Forward Primer Reverse Primer Extension sequence SD SC
TC006 GGGTATAGGGTTTGATCAAC TTGAGGACCTTTTACGCAAC AAGACCTGTGAAGAA G T
TC008 GGTTGATTGATTTTGCCTCC TGGAGTGCAAAAGTCCATCG GCCTCCATAGGCTCC C T
TC011 ATGAAAGACTCTTAAGTCG GATGTCTCACAAATCTCGCC ACTCTTAAGTCGACAGAC T A
TC012 GCAAACAGGACCGTGTTGAA ACAAGATGGAACGGGTAGAG CGTACACCTTGATCTTGCC C G
TC016 GTGAGTTTTGTCTCAAACGG ATTGCCAAGCCAAGTAAGCG TTTGTCTCAAACGGTTCACCCA G A
TC017 ATGCTTGGCAATTTGGAGTG TTTACCTCCAGGACATTGGC GCAATTTGGAGTGTTCTGA C T
TC033 TCCCCAAGAGCAATAATCGG GATCGAAGTTTTGGTAGGTC TGAGAAAATCTCCTACTTACC C G
TC040 GAGGAAGTAGAGCCAATAGC ACCACGATGGAAGTTGCTTG CCAATAGCAACCATCA C T
TC043 GCATTGAGGATTGTGGCTTC TGAGGAAAAATCACGTCCGC ATTGTGGCTTCACACCTA C T
TC045 ATTGGGATCCGACCCTGTTG GGTTTGAACACCTGAAATGG GGGATCTGGTTGTC T C
TC046 GGGAAAACGGGCTCAAGATG AAAGCTGCCCTTGTAAACGC ACAAATTGGCTTTGCTTGG C T
TC051 TCAAGCGAAACACCACCATC TCGTACACCTGAATGGTGAC CTTCACCACCTACTC C T
TC060 GAGGACCCATTTTTCCACAC TCTTTTACAAGCACTCCTC GAAGTCATCACACACG G A
TC073 ACTTGGATGTGGTGTCCTTG CCAACACCAATGTCACCATC GTGGTGTCCTTGGCCTCA T A
TC074 TTGCTCAAGTCAACCATGCC GCAACCAGTTGATAGCTTCC TCCTGTATTTTGCCT C G
TC077 GTCTCAAACGCGAATGCAAG TTGCTTGGTTCGAGGACATC AGAAGCCACGGCCACGTTTTC T C
TC078 GGGTACTGTGGTGTCGATTC AAGAGGACAGCAAATGGGAC TGTCGATTCTCCTCGG C G
TC084 GCAAATTCTGGTCCACCATC ATGCACGTTTATGGCTACCG TTTATCCGTACTGGTCTC T C
TC085 GAAGCCGACATCAAAATGAC AAGGACAAATCTCCCATTGC CATCTGAACCAGAAATCCATC C A
TC099 TAGCAATCTTCGGTCACCAC CAGCCCATTATGATTGCTCG GGGTTTCCACGGGATA T C
TC102 GCGTCAACGATGTTGAGAAC TGGTGCCCATACATGAGTTC GAACTTCATGGCCTTGAAGAT A T
TC103 GAGATCTCAGGAGAGTTGC AATGAGGAATCTTCTCTGGC GAGTTGCAACATCTC T C
TC104 GCTTACTTCATTCACGCACC GAGACTTTGAGCGTCTGAAC CCATTATTTAGTCTATCCAAGA A G
TC106 CATTTCTTCTCCCACACCAG AATGAGAAGCAATGCTCCTG ACGGGGATCTTGAC C T
TC107 CCTTCCCATAAAGGTCAATC TGGAAAGAAACGGGAAGTGC AAAGGTCAATCAATGACT C A
TC111 AAGTGTCTCTGCGAGTGCTG TTCGAATGATGGGATCCGTG CAACCTTCGTCGGATGTTCCCGG C G
TC112 TGGCTGCCTTTGAAGAGAAC GAAACATCAAAGCAAGCAGG AGAGAACATCACCTAA C T
TC118 TCAAGGACACCATCAAGAGC TCCGGACAAGATGTTCTTGC AGAAGGACGCCTCCTA T C
TC124 ACACCAAACCATTGAGTGGC ATATGTAGAAGACCGAGAGC TACCCTGTTGATGCGA C T
TC125 TTGTTGGACTTGATGCCTCG GCTCGTATTGCTCGATCTTG ATGTGGACAAATTGAA G A
TC128 TGTCGTATCTCGTCCTCTTC AGAACACGAGAAGAAATTC CTCGTCCTCTTCTTGGAATC G A
TC130 ACGTTCGTTTGTTAAGGCGG GAACATTGCTGACAACGGAG GTTTGTTAAGGCGGTAACTG G A
TC152 CGCCCCAGACGACGACGA ATGCATTCGCGAAAGGCCTG CTCCCTCAAAGCCTC A G
TC155 TTGGATCAGATCCAGCGGT GCGAGGATTTGCAAGTACAC AGATCCAGCGGTGCCTTAAACC A C
TC156 AATTTGATCTAGGAGCAACG GCATTCAGTTCCAGTTTGAG GGAGCAACGTTGCATTG C T
TC157 CAAGTTCCTGGCCAAGAAAG TCCATGAACATGTCCATCT GGGAACGATGATTTGGAA G C
TC162 GAAGATGCTTGAGTGGATGG TCGGCGGAGGTGTACACTTT AAGGCAATCTCCAGGAT T C
TC167 TGGCATCTTGATGTTTTCGC ACTGAGGAAGGATCTTGAGG AGGTTGGTCATTGT T C
TC169 GTAGCCCCTCAAGGTTATGC TCACGCTTGGCAACATGGAG AAGGGCCAATATGTGGC T C
TC171 ATGTCTCAAAACGGCCTTCC TCGAGGAAGTTTCGTTGCAC GCCTTCCGGATCAGCGGTA T C
TC180 AATGTCTCGCAAGAGCTGG TGGTGGTTACCTTTCGAAAT GAGCTGGACCCAGACAC T C
TC184 CTCCCGAATATCATGAAGGC GGGTCCTCAACGGAAATAAC AACCCTCAGATTTGGGAGT G C
TC188 GGTCATTCTTCGAGACCTAC CGATACTTTTTTGAGAGTAGG ACTCAACATGTCTGT G A
TC189 AGACGTTATGAAGCACGACC TTTGTTATCTTCCAAGGGC GCACGACCCAATCCGTGTC T A
RPOL CACGTTCATTCAAAGCGGAC AATCCAAGATTTCAACCTC GGTTGGTAAGTCGG G T
  1. Abbreviations refer to the following T. californicus populations: SD: Point Loma, San Diego, California (32º45'N, 117º15'W; n = 28), SC: Santa Cruz, California (36º57'N, 122º03'W; n = 28). Additional file 1, Table S1 provides information on additional SNP loci and SNP calls for additional populations.