Skip to main content

Advertisement

Table 2 Table lists primers used in confirming breakpoint mapping for the cases listed in this manuscript

From: Detection limit of intragenic deletions with targeted array comparative genomic hybridization

Primer name Primer sequence
PAH_bkpt_ex6_F GCTAAATTAACATCCTCTTGACAGAA
PAH_bkpt_ex6_R ACCCTTTCATGTGGGAAATC
STK11_bkpt_ex8_Fa CCAGTGGCCTTGGGAGAA
STK11_bkpt_ex8_Fb GAGATGCGCCAGGAAGG
STK11_bkpt_ex8_R GGCTGGCTGCCAATGTG
STK11_bkpt_ex3_F GTTGTGGGCCATTTTGGT
STK11_bkpt_ex3_Ra TGGCCTCACGGAAAGGA
STK11_bkpt_ex3_Rb CAGCAAAGATGGAGGCG
STK11_bkpt_ex3_Rc ATTTTCCTGTGGGCCACAGG
STK11_bkpt_ex3_Rd AATCAGCTGACAGAAGT
HPRT1_bkpt_ex5_Fa TATATGACAGAGTATGATGAGAGCTACA
HPRT1_bkpt_ex5_Fb GCCTCATTCTTATAACTAGCATAAGAAC
HPRT1_bkpt_ex5_R ACAGTGGCTCATGCCTAT
EMD_bkpt_ex2_F CTCGGCCGGTTTTGGTA
EMD_bkpt_ex2_Ra CAGACTTCCCTCCCCTTTCT
EMD_bkpt_ex2_Rb AGGTCTCAGGTCCTCCCTGT
DBT_bkpt_int4_F CAGAGATACAAATGTACACTTCCTA
DBT_bkpt_int4_Ra AGTTGTGTTTTCCTATTCTGAAGTAGTT
DBT_bkpt_int4_Rb TGACATATCCACCAGGTACTAATAATTAAA
POMT1_bkpt_ex3_F CAGGATTAGCCTTGCGTC
POMT1_bkpt_ex3_Ra GGCAAGCAATAAACAAGATGC
POMT1_bkpt_ex3_Rb TCTGTGGGACTAGGTATGAAAGG
F-Alu_sense GTCTCGATCTCCTGACCTCG
SLC9A6_ex9_F TCTACTGTGAAGAAAGAACCTCAG
SLC9A6_ex9_R GGAAGAGGAGCCAAAATGAG
GALT_ex9_F CTAGGCACTGGATGGAGGTT
GALT_ex9_R TCACTAGGCTGAGCCCCAGG