Skip to main content

Table 2 Primer sequences used for PCR amplification and sequencing

From: A heterozygous variant in the human cardiac miR-133 gene, MIR133A2, alters miRNA duplex processing and strand abundance

Primer name Primer sequence Amplicon size (bp) Sequencing primer
mir-1-1F 5- gagatggattcagggatgga -3 494 mir-1-1R
mir-1-1R 5- acctgctgacacaggcaaag -3   
mir-1-2F 5- ggaaccattaatgccatgct -3 467 mir-1-2F
mir-1-2R 5- tgaaatctacttcactggatcttctt -3   
mir-133a-1F 5- tttaaaccattaagcgcagga -3 455 mir-133a-1F
mir-133a-1R 5- ttgaaatccttaagtcatccataca -3   
mir-133a-2F 5- ctgcagagcttgagggaaac -3 466 mir-133a-2R
mir-133a-2R 5- caaggaggaacaagcaggag -3   
mir-133bF 5- agtcatgcaacatgaaatacaaa -3 500 mir-133bR
mir-133bR 5- gagtgcaaaggcacagaaca -3