Skip to content


Open Access

A multicopy Y-chromosomal SGNH hydrolase gene expressed in the testis of the platyfish has been captured and mobilized by a Helitron transposon

  • Marta Tomaszkiewicz1, 3,
  • Domitille Chalopin1,
  • Manfred Schartl2,
  • Delphine Galiana1 and
  • Jean-Nicolas Volff1Email author
BMC Genetics201415:44

Received: 18 July 2013

Accepted: 19 March 2014

Published: 8 April 2014



Teleost fish present a high diversity of sex determination systems, with possible frequent evolutionary turnover of sex chromosomes and sex-determining genes. In order to identify genes involved in male sex determination and differentiation in the platyfish Xiphophorus maculatus, bacterial artificial chromosome contigs from the sex-determining region differentiating the Y from the X chromosome have been assembled and analyzed.


A novel three-copy gene called teximY (for testis-expressed in Xiphophorus maculatus on the Y) was identified on the Y but not on the X chromosome. A highly related sequence called texim1, probably at the origin of the Y-linked genes, as well as three more divergent texim genes were detected in (pseudo)autosomal regions of the platyfish genome. Texim genes, for which no functional data are available so far in any organism, encode predicted esterases/lipases with a SGNH hydrolase domain. Texim proteins are related to proteins from very different origins, including proteins encoded by animal CR1 retrotransposons, animal platelet-activating factor acetylhydrolases (PAFah) and bacterial hydrolases. Texim gene distribution is patchy in animals. Texim sequences were detected in several fish species including killifish, medaka, pufferfish, sea bass, cod and gar, but not in zebrafish. Texim-like genes are also present in Oikopleura (urochordate), Amphioxus (cephalochordate) and sea urchin (echinoderm) but absent from mammals and other tetrapods. Interestingly, texim genes are associated with a Helitron transposon in different fish species but not in urochordates, cephalochordates and echinoderms, suggesting capture and mobilization of an ancestral texim gene in the bony fish lineage. RT-qPCR analyses showed that Y-linked teximY genes are preferentially expressed in testis, with expression at late stages of spermatogenesis (late spermatids and spermatozeugmata).


These observations suggest either that TeximY proteins play a role in Helitron transposition in the male germ line in fish, or that texim genes are spermatogenesis genes mobilized and spread by transposable elements in fish genomes.


Platyfish Xiphophorus maculatus Sex determinationSex chromosomesY chromosomeTestisSGNH hydrolase Helitron Transposition


In contrast to the situation observed in mammals and birds, where sex determination systems and master sex-determining genes have been conserved over long periods of evolution, sex determination is hypervariable in teleost fish [14]. Related fish species and even populations can have different genetic sex-determining systems, with various impact of environmental factors. Fish sex chromosomes are generally poorly differentiated. They are therefore considered to be evolutionary young and might have emerged independently in different fish lineages. Hence, parallel studies on different fish models are necessary to better understand the evolutionary dynamics of sex determination in fish.

Such studies have demonstrated that different, even closely related fish species can have different master sex-determining genes. The first master sex-determining gene in fish has been identified in the medaka Oryzias latipes. This gene, dmrt1bY, is a Y-chromosomal duplicate of the autosomal gene dmrt1, which encodes a transcription factor with DM domain involved in male development in vertebrates [5, 6]. Interestingly, dmrt1bY is not present in related species from the same genus, which therefore must possess other master sex-determining genes. This is the case in Oryzias luzonensis, where the putative master sex-determining gene is gsdf (gonadal soma-derived growth factor), another gene from the sex-determining cascade [7].

More distant species have also different master sex-determining genes. In the Patagonian pejerrey Odontesthes hatcheri, a Y-linked duplicate of the amh gene, which encodes the anti-Müllerian hormone belonging to the TGF-β superfamily, might drive sex determination [8]. In the rainbow trout Oncorhynchus mykiss, the master sex-determining sdY is a Y-specific duplicate of the interferon regulatory factor 9 gene [9]. Added to the results obtained in O. latipes, these observations underline the importance of gene duplications in the formation of new master sex-determining genes in fish. However, the situation is different in pufferfishes from the Takifugu genus. In Takifugu, phenotypic sex might be controlled by two alleles of the anti-Müllerian hormone receptor type II gene amhr2, which is located on both the X and Y chromosomes. A single nucleotide polymorphism differentiating both alleles affects one amino-acid in the kinase domain of Amhr2. Females are always homozygous for one allele, while males are heterozygous [10]. Hence, hypervariability of sex determination might be associated with frequent evolutionary switch of master sex-determining genes at the top of more conserved downstream components of the sex determination and differentiation cascade, following the principle of “masters change, slaves remain” [11]. Further studies on different fish models are necessary to test the extent of this hypothesis.

Another classical fish model to study sex determination is the platyfish Xiphophorus maculatus. This species possesses three different types of sex chromosomes: X, Y and W. Males can be XY or YY, while XX, WX and WY genotypes lead to female development [12]. Using a strain with XY male heterogametic sex determination, the positional cloning of sex-linked genes has been initiated. A bacterial artificial chromosome (BAC) genomic library of XY males has been constructed, and BAC contigs covering the region differentiating the X from the Y chromosome have been assembled and sequenced [13, 14]. Very recently, the genome of an XX female has been sequenced [15]. The sex-determining region was found to be prone to DNA rearrangements including deletions, transpositions and duplications [12, 16]. We report here the identification of a novel gene called teximY, which is found in there copies on the platyfish Y chromosome but absent from the X chromosome. This gene is preferentially expressed in testis, and has been captured and mobilized by a Helitron transposon in fish.


Three teximYgenes are clustered in the sex-determining region of the platyfish Y chromosome but are absent from the X chromosome

Four overlapping Y-linked BAC clones (B14, B29, B17 and N20; Figure 1) from the Rio Jamapa platyfish BAC genome library [13] were sequenced to completion and assembled, resulting in a total sequence of 585,694 bp in length. BAC clone B29 contained a pseudogene called Y-cript. PCR analyses demonstrated the presence of Y-cript in all males tested (> 200 individuals) but its absence from all females (> 200 individuals) (data not shown). Hence, the four assembled BAC clones are closely linked to the master sex-determining gene on the Y chromosome, or may even contain it.
Figure 1
Figure 1

Structure of the teximY gene cluster in the sex-determining region of the Y chromosome of Xiphophorus maculatus . Red arrowheads show the position and predicted transcription orientation of teximY copies. The four sequenced BAC clones (B14, B29, B17 and N20) are shown as black lines. The distance between teximY copies is given. Locations of the Y-specific Y-cript pseudogene and of two copies of the type 4 melanocortin receptor gene mc4r[14] are indicated.

Further sequence analysis revealed the presence of three copies of a new gene candidate that was called teximY (for testis-expressed in Xiphophorus maculatus on the Y) in a region of approximately 300 kb (Figures 1 and 2). These three genes were detected neither in BAC clones specific of the X chromosome nor in the genome sequence of an XX female ([15]; The presence of teximYa, teximYb and teximYc was tested by PCR in 34 platyfish individuals from the Rio Jamapa population (17 males and 17 females). All males tested were positive for the three genes, while all females were negative. This confirmed the presence of teximYa, teximYb and teximYc on the Y chromosome of the platyfish in the Rio Jamapa population. TeximY genes are located at distances between 80 and 280 kb near Y-cript and linked to two copies of a type 4 melanocortin receptor gene mc4r[14].
Figure 2
Figure 2

Exon/intron structure of texim genes in the platyfish genome. The SGNH hydrolase domain(-coding region) is marked in light blue. Introns are represented by broken lines. Predicted start codons are in green and stop codons in red. cDNA and predicted protein sizes are provided. Helitron transposon positions are indicated. Question marks indicate lack of information due to absence of sequence data. Both coding and protein sequences of texim4 are partial.

All three teximY copies were in the same transcriptional orientation (Figure 1). They showed 95-98% nucleotide identity at the cDNA level and 89-97% amino acid similarity, suggesting recent duplication events. Software-based gene structure prediction as well as sequence comparison with platyfish expressed sequence tags and sequencing of RT-PCR and RACE-PCR products indicated that the teximYa and teximYb genes are both composed of 15 exons, while teximYc is a truncated version lacking the last two 3′ exons (Figure 2). Sequence comparison of teximYa and teximYb flanking regions revealed extensive sequence identity for more than 5 kb upstream and more than 7 kb downstream of the genes, suggesting a duplication of at least 25 kb. This analysis could not be performed for teximYc neighboring regions due to the missing adjacent genomic sequences.

BLAST analysis of the platyfish female genome sequence [15] revealed the presence of several teximY-related sequences. These sequences were not present on sex-chromosomal BAC contigs covering the region differentiating the X from the Y chromosome [13, 14]. They are therefore located either on autosomes, or alternatively in homologous regions of the X and the Y chromosomes (pseudoautosomal regions). One copy called texim1 presented a high level of nucleotide identity (> 95%) with the Y-chromosomal teximY genes as well as a very similar gene structure (Figure 2). Hence, texim1 might correspond to the molecular progenitor of teximY sequences, or texim1 is a (pseudo)autosomal duplicate of one of the teximY genes. Three more divergent texim genes were also detected in the genome, with one of them, texim2, mapping to autosomal linkage group 18. Altogether, four copies of texim are present in platyfish (pseudo)autosomal parts of the genome, with three additional Y-specific copies only in males.

Teximgenes encode putative SGNH hydrolases found in fish and other metazoans

In silico analysis of conserved domains identified a SGNH hydrolase domain in the predicted Texim proteins. This domain, which is found in certain esterases and lipases with broad substrate specificity and regiospecificity [17], is characterized by four invariant catalytic residues: the catalytic serine (S) at the N-terminus in conserved block I, a glycine (G) in conserved block II, an asparagine (N) in conserved block III and the catalytic histidine (H) in conserved block IV (Figure 3). An aspartate residue (D) is often present in block IV. The four major residues (S, G, N and H) are important for activity, with a different catalytic mechanism when compared to common alpha/beta-hydrolases [18].
Figure 3
Figure 3

Conserved amino-acid blocks in the SGNH domain of predicted Texim proteins. Critical residues important for catalytic activity and oxyanion hole residues are indicated, as well as minimum-maximum amino-acid distances between the domains.

Sequence database analysis identified texim sequences in different fish species including killifish, medaka (2 very similar copies on chromosomes 10 and 21), pufferfish (one copy in Sphoeroides nephelus), sea bass, Atlantic cod (one copy) and gar (one copy). No sequence was detected in zebrafish. Texim sequences were also found in Oikopleura (urochordate, one copy), in Amphioxus (cephalochordate, three copies) and sea urchins (echinoderms, two copies). Texim genes were absent from mammals and other tetrapods, suggesting loss of these sequences after divergence from the fish lineage 400-450 million years ago, or alternatively introduction of texim into the fish lineage through horizontal gene transfer.

All identified Texim sequences form a phylogenetic group distinct from other proteins with SGNH domains (Figure 4). Within the SGNH hydrolase family, Texim proteins are related to proteins from very different origins, including bacterial hydrolases, animal platelet-activating factor acetylhydrolases (PAFah) and proteins encoded by animal CR1 retrotransposons. No reverse transcriptase was found to be associated with any texim sequence, suggesting that texim is not part of a CR1 retrotransposon.
Figure 4
Figure 4

Maximum likelihood phylogenetic tree of Texim-related SGNH hydrolase protein domains found in different organisms. The Maximum Likelihood phylogenetic tree is based on an alignment of 112 amino-acids from the SGNH hydrolase domains. Bootstrap values are indicated (1000 repetitions). Accession numbers: Fish Texim: Lipase_GDSL2_Sphoeroides: Sphoeroides nephelus, protein prediction, AF094698.1; Lipase_GDSL2_Dicentrarchus: Dicentrarchus labrax, protein prediction, LG1, FQ310506.3; Lipase_GDSL2_Oryzias: Oryzias latipes, protein prediction, ENSEMBL, LG1:scaffold 395; Lipase_GDSL2_Fundulus-2: Fundulus grandis, JW608837.1; Lipase_GDSL2_Fundulus: Fundulus grandis, JW617431.1; Lipase_GDSL2_Gadus: Gadus morhua, consensus sequence from ESTs EL616197.1, ES481574.1 and ES474748; Sialate_O-acetylesterase_like2_Lepisosteus: Lepisosteus oculatus, protein prediction, LG7. Invertebrate deuterostome Texim: Hydrolase_like1_Amphioxus: Branchiostoma floridae, XP_002590490.1; Hydrolase_like1_Amphioxus-2: Branchiostoma floridae, protein prediction, scaffold 113; Hydrolase_like1_Strongylocentrotus: Strongylocentrotus purpuratus, protein prediction, scaffold 80934; Lipase_GDSL2_Lytechinus: Lytechinus variegatus, JI442514.1; Sialate_O-acetylesterase_like2_Strongylocentrotus: Strongylocentrotus purpuratus, XP_003726742.1; Hydrolase_like_Amphioxus: Branchiostoma floridae, XP_002586334.1; Hydrolase_like_Oikopleura: Oikopleura dioica, CBY22153.1. Accession numbers for PAF acetylhydrolases, prokaryotic hydrolases, CR1 retrotransposons and outgroups are available upon request.

Texim is associated with Helitrontransposons in fish but not in other animals

For all platyfish texim genes for which enough flanking sequence data was available for analysis, a Helitron transposon coding region was identified at the close vicinity 3′ from texim genes (3 kb downstream from the stop codon of texim2) or even in the last intron for teximY/1 (Figures 2 and 5). Helitrons are eukaryotic rolling-circle DNA transposons [19, 20]. They are able to capture and mobilize gene sequences in certain organisms and might therefore play a role in gene evolution through exon shuffling and gene duplication [21, 22]. Texim was also found to be associated with Helitrons in other fish species including medaka, pufferfish and sea bass (Figure 5). Association between texim sequences and Helitrons transposons was found neither in Oikopleura (which does not have Helitrons) nor in Amphioxus and sea urchins (which contain Helitrons). These observations suggested capture and mobilization of an ancestral texim gene by a Helitron element in the fish lineage after divergence from urochordates/cephalochordates. “Free” Helitron transposons not associated with texim genes are present in zebrafish (which is devoid of texim genes) as well as in platyfish and other fish species possessing texim-Helitron associations.
Figure 5
Figure 5

Association of texim genes with Helitron transposons in different fish species, plotted on a Texim molecular phylogeny. Texim phylogeny was performed on a 112 amino-acid alignment using the Maximum Likelihood method with 100 bootstraps (values are provided). Blue boxes indicate texim exons, light blue regions encode the SGNH domain. Grey boxes show Helitron transposons, broken boxes indicate that the coding region is corrupted by point mutations. Nucleotide distance between texim and Helitron is provided. Accession numbers are given in the legend of Figure 4.

TeximYgenes are preferentially expressed in testis in adult platyfish

Expression of X. maculatus texim genes was analyzed by RT-qPCR in the Rio Jamapa population used to construct the BAC library (XY males and XX females, Figure 6), as well as in the Rio Usumacinta population (YY males and WY females) (Figure 7). The (pseudo)autosomal copies of texim, namely texim1, texim2, texim3 and texim4, were all detected by PCR in genomic DNA of both males and females of the Rio Usumacinta population. From the three Y-linked copies, only teximYb was found in Rio Usumacinta. In this population, teximYb was detected by PCR in both males and females, suggesting localization either on the Y chromosome-specific segment or on (pseudo)autosomal regions.
Figure 6
Figure 6

RT-qPCR expression analysis of texim genes in adult tissues of Xiphophorus maculatus population Rio Jamapa. All qPCR results were normalized against the ribosomal protein L7 housekeeping gene rpl7, the value 1 was assigned to the tissue/organ with the highest level of expression. M: males (in blue); F: females (in red). TeximYa, teximYb, texim1 and texim4 are preferentially expressed in testis, with teximYb being almost exclusively expressed in the male gonad. Texim1 is also significantly expressed in ovaries. Texim2 and texim3 show predominant expression in brain.

Figure 7
Figure 7

RT-qPCR expression analysis of texim genes in adult tissues of Xiphophorus maculatus population Rio Usumacinta. All qPCR results were normalized against the ribosomal protein L7 housekeeping gene rpl7, the value 1 was assigned to the tissue/organ with the highest level of expression. M: males (in blue); F: females (in red). All texim genes are strongly expressed in testis, with teximYb and texim2 being almost exclusively expressed in the male gonad. Texim1 is also strongly expressed in gills, and texim4 in brain.

In both populations, teximYa (when present) and teximYb were both preferentially expressed in testis, with teximYb being almost exclusively expressed in the male gonad (Figures 6 and 7). We could not detect any expression for teximYc, suggesting that this truncated sequence corresponds to a pseudogene. Texim1 was strongly expressed in testis and also in gills in both platyfish populations. In addition, a significant expression was found in ovary in the Rio Jamapa population. Expression of other texim genes was generally strong in the testis, with exception of texim2 and texim3 in the Rio Jamapa population, which are predominantly expressed in the brain (Figure 6).

Teximis expressed in spermatozeugmata and late spermatids in platyfish testis

Expression of texim gene in platyfish adult testis was further analyzed by in situ RNA hybridization. Histological analysis of the platyfish testis revealed the presence of many spermatozeugmata, i.e. the aggregation of mature sperm (Figure 8A). Hence, the testis analyzed was at stage VI of maturation (according to [23]). The vasa gene, encoding an RNA helicase of the DEAD box protein family, was used as a control for gene expression in germ line [24]. According to expression patterns observed in other fish species, vasa was expressed in spermatogonia and primary spermatocytes in the platyfish (Figure 8B/C). In situ hybridization for texim1/teximY (the probe used does not allow to differentiate between teximY and texim1) showed expression in late spermatids and spermatozeugmata, i.e. at late stages of spermatogenesis (Figure 8D/E).
Figure 8
Figure 8

In situ RNA hybridization analysis of vasa and texim1/Y expression in platyfish adult testis. A. Transversal testis section stained with Masson’s trichrome. B. Vasa sense probe, C. Vasa antisense probe, D. Texim sense probe, E. Texim antisense probe. SG, spermatogonia; SC, spermatocytes; ST, spermatids; SZ, spermatozeugmata. The probe used does not allow to differentiate between teximY and texim1. Scale bars: 50 μm.


Gene duplications play a major role in the formation of novel master sex-determining genes in fish [5, 7, 9] and other organisms [25, 26]. New master genes appearing at the top of the sex determination cascade are generally derived from genes already involved in sexual development, as exemplified by the dmrt1bY master gene of the medaka [5, 6]. However, exceptions may exist, as suggested for the immune gene paralog sdY recruited as the master sex-determining gene in the rainbow trout [9]. Frequently, master sex-determining genes in vertebrates encode transcription factors (Sry in therians, Dm-W in Xenopus laevis, Dmrt1 in Gallus gallus, dmrt1bY in Oryzias latipes), but some recent data have demonstrated that it is not the general rule, at least in fish (gsdf Y in Oryzias luzonensis, amhY in Odontesthes hatcheri and amhr2 in Takifugu rubripes[7, 8, 10]). Importantly, all master sex-determining genes identified so far in fish are expressed in the same manner, in somatic cells surrounding the germ cells of the differentiating gonads.

In the platyfish Xiphophorus maculatus, an ovoviviparous teleost species, the master sex-determining gene has not been identified so far. Only a few functional genes have been described in the sex-determining region, including the multicopy melanocortin receptor gene mc4r, which controls the onset of puberty and is present on both the X and the Y chromosomes [14, 27].

In this study, we have identified a new multicopy gene called teximY, triplicated on the Y but absent from the X chromosome. TeximY genes are located at distances between 80 and 280 kb near Y-cript, a Y-specific pseudogene linked to the sex-determining locus. The sex-determining region of the platyfish is very rich in repetitive DNA [16]. Accordingly, the repeat content of the 0.5 Mb region analyzed in this study is as high as 65.2% (unpublished results). In addition, the region containing the master sex-determining gene is characterized by a high level of genomic plasticity, with frequent rearrangements such as duplications, deletions and transpositions [12, 16]. The presence of three copies of texim is consistent with the frequent duplications observed in this region. The autosomal texim1 gene is a possible molecular ancestor of the Y-linked cluster. Y-chromosomal texim copies might be the result of mobilization by the flanking Helitron transposons, or might have been embedded in larger segmental duplication events. TeximY genes are preferentially expressed in the testis. Hence, the situation observed on the sex chromosomes of the platyfish is consistent with the observation that new sex-biased genes, especially male-biased genes, can be formed on sex chromosomes through the duplication of autosomal genes [28].

There is so far neither biochemical nor biological data concerning the functions of TeximY. Identification of conserved SGNH hydrolase domains in predicted sequences strongly suggests that Texim proteins work as esterases/lipases [17]. In contrast to master sex-determining genes described so far in fish, teximY genes are not expressed in somatic cells in the adult testis. Hence, teximY genes might not correspond to platyfish master sex-determining genes. However, additional expression analyses remain to be performed to test if these genes are expressed during embryonic development at the onset of sex determination.

We have shown that teximY genes are expressed in late spermatids and spermatozeugmata, suggesting that these genes might function at late stages of spermatogenesis. Interestingly, Texim is related to the platelet-activating factor (PAF) acetylhydrolase (PAFah) present in different animals. In mammals, PAFah is involved in reproduction [2934], but also in other biological processes such as development, inflammation, hemostasis and apoptosis. This enzyme regulates PAF activity via deacetylation [29]. It reduces the level of PAF [33], but can also be involved in signaling pathways via interaction with other proteins in different tissues including testis [32, 33, 35, 36]. Recently, a new testis-specific protein isoform of Pafah1b2 with possible role in spermatogenesis has been identified, the knock-out of which causes male infertility in the mouse [32].

Texim proteins are also related to prokaryotic proteins. Hence, either prokaryotic or eukaryotic texim-like genes share a very ancient common ancestor, or a horizontal transfer between prokaryotes and eukaryotes was involved in the evolution of texim-like sequences. In addition, Texim proteins show homology to proteins with esterase domains encoded by animal CR1 retrotransposons. These enzymes might play a role in interactions with cellular membranes, helping the element in penetrating host cells and possibly facilitating horizontal transfer [37]. Texim genes are not parts of retrotransposons, since they possess multiple introns and are not associated with reverse transcriptase genes. However, we cannot exclude that texim sequences have evolved from ancestral CR1-like elements.

Interestingly, texim sequences in fish are associated with another type of transposons, rolling circle DNA transposons called Helitrons. Such elements have been already identified on the sex chromosomes of the platyfish [38]. Helitrons are able to capture and mobilize resident coding sequences particularly in plants, and might therefore be involved in the evolution of gene functions through exon shuffling and gene duplication [21, 22]. The absence of association between texim and Helitrons in urochordates, cephalochordates and echinoderms suggests that the capture event took place specifically in the fish lineage. Texim genes might facilitate Helitron transposition and transmission in a way similar to the role proposed for the Texim-related esterase in CR1 retrotransposons [37]. However, most Helitron transposons are not associated with texim in teleosts, indicating that mobilization and spread of Helitrons do not absolutely require Texim even in fish. Patchy distribution of texim in fish and other vertebrates suggests either recurrent loss of texim (e.g., in zebrafish and tetrapods) or horizontal transfer of texim, possibly in association with Helitrons.


Texim genes in the platyfish uncover a novel multigene family encoding proteins with SGNH hydrolase domain, for which no functional data is available so far. The Y-specific copies teximYa and teximYb have no counterparts on the X chromosome and are specifically expressed in late spermatids and spermatozeugmata. Texim genes are associated with Helitrons in fish genomes, suggesting that they have been captured and mobilized by these transposons. Two non-exclusive hypotheses can explain these results. On the one hand, texim genes might have been maintained in Helitrons because Texim proteins facilitate the transposition or transmission of these elements. Alternately, texim genes might correspond to fertility genes with advantageous male functions mobilized and spread by Helitrons transposons. Such genes, which may have deleterious effects on females, are frequently located on the male-specific Y chromosome in animals. Fish present a very important evolutionary turn-over of sex chromosomes. Transposon-mediated mobility of fertility genes might allow the rapid fixation of spermatogenesis genes on neo-Y chromosomes, as suggested by the presence of three teximY genes on the Y but not on the X chromosome of the platyfish.



Xiphophorus maculatus males and females analyzed in this study belong to populations Rio Jamapa (Jp163A) and Rio Usumacinta (Up-2) reared at the Plateau de Recherche Expérimentale de Criblage In vivo (PRECI) of the SFR BioSciences Gerland - Lyon Sud (US8/UMS3444, Lyon, France) and the fish facility of the Biozentrum at the University of Würzburg (Germany). Fishes were kept under standard conditions and sacrificed following protocols in accordance with regulations from the French Ministry of Agriculture and the European Union (agreement number A693870602).

In silicosequence analysis

Gene structure and protein sequences were predicted using FGENESH with the fish training set ( Intron-exon structure was determined by sequence comparison with Expressed Sequence Tags (ESTs) downloaded from Genbank as well as by sequencing of RT-PCR and RACE-PCR products. BLAST analyses were mainly performed against sequence databases accessible from the NCBI ( and ENSEMBL ( servers. Sequence alignments were done using MUSCLE [39] via SeaView [40, 41] and BioEdit [42]. Phylogenetic reconstructions were performed by Maximum Likelihood using PhyML 4.0 with 1000 bootstrap repetitions under the LG model, with the following additional parameters: optimized invariable sites, BioNJ as a starting tree and Best of NNI & SPR tree searching options [41]. The VISTA online software was used to perform alignments with mVISTA plot in order to visualize the level of sequence conservation ( Conserved protein domains were detected via NCBI (, PFAM ( [43] and annotated with Gene Ontology terms ( [44]. Xiphophorus autosomal and Y-linked texim sequences have been deposited in GenBank under accession numbers [KF433067- KF433073].

Gene expression analysis

Total RNA was extracted from brain, eyes, gills, liver, spleen, muscle, skin and gonads of X. maculatus males and females from the Rio Jamapa and Rio Usumacinta populations using the TRIZOL reagent (Molecular Research Center, Inc.). Reverse transcription was performed with 1μg of total RNA using RevertAid First Strand Synthesis kit and oligo-dT primers (Fermentas). Expression patterns were determined by quantitative RT-PCR using gene-specific primer pairs. Primers used were GCTGCTTGCAGTTTGGATT and GTTTGATGGAGCCATGACA for teximYa, AGCCACGGGATGCAGAT and GTTCCTGTCCCTTAACCACAAC for teximYb, AGCCACGGGATGCAGAT and GTTCCTGTCCCTTAACCACAAC for texim1, CCTCTGCGGAAGAGTTGAAG and GTACGCAACAAAGCGTCAAA for texim2, GGAGACCTGCTGGACTCTTC and TTCCACCTTCGGACAACATA for texim3, and GACGCTCTGAGGCAGCTAA and CATCACGGGAGGCAACAT for texim4. Analysis of relative gene expression was done using the DeltaDeltaCt method [45]. All qPCR results were normalized against the ribosomal protein L7 housekeeping gene rpl7 ([46, 47] Additional file 1: Figure S1).

In situRNA hybridization

In order to generate probes for in situ hybridization, platyfish vasa (663 bp, [GenBank: KF424536], primers GGTTACCGTGGAAAAGACGA and CACCTTTCCTCTCCCAATCA) and texim1 (542 bp, primers TTGGCTGTCTGTTCTCGTTG and GAGAAACGGACAGGATTGGA) partial cDNAs were amplified by PCR from testis. Amplified fragments were cloned into the pCR®II vector (Invitrogen Life Technologies). Digoxigenin (DIG)-labeled antisense RNA probes were synthesized by in vitro transcription from HindIII-linearized plasmid constructs using the SP6 RNA polymerase, while negative control sense RNA probes were produced from XhoI-linearized constructs using the T7 RNA polymerase. In situ hybridizations were performed on testis sections. Testes were fixed in 4% paraformaldehyde (PFA) in Phosphate Buffered Saline (PBS) buffer at 4°C overnight. After several washes in ethanol and then in toluene, testes were embedded in paraffin. Sections of 8μm were cut using a microtome and then slides were prepared. After deparaffinization of slides with xylene followed by several washes in 100% and 70% ethanol and PBS, testes were incubated for 20 min with proteinase K (20 μg/mL). Prehybridization was performed for 1 hour at room temperature in the hybridization buffer composed of 50% formamide, 20X Saline Sodium Citrate (SSC) buffer, 0.1% Tween-20, 10.5 μg/ml yeast tRNA, 0.05 mg/ml heparin, 5μg/ml salmon sperm DNA and 1X Denhardt’s solution in diethylpyrocarbonate (DEPC)-treated water. Both antisense and sense probes were diluted in the hybridization buffer for 3 min at 80°C. Slides with 100 μl of probe (1 μg/ml) were covered with hybridslips and hybridized in hybridization buffer at 70°C overnight. The next day, after removal of hybridslips in 5X SSC, slides were washed five times in hybridization washing solution (5X SSC, 50% formamide, 0.1% Tween-20 in distilled water) at 70°C for 30 min, then two times in 2X SSC at 70°C for 30 min and four times in Tris-Buffered Saline (TBS) buffer for 5 min. Slides were subsequently incubated for 1 hour in a blocking solution (1mg/ml, Roche), followed by incubation in an anti-DIG alkaline phosphatase conjugate (Roche). The next day, slides were washed four times in TBS for 5 min and two times in alkaline phosphatase buffer (NTMT; 0.1M Tris-HCl, 0.1M NaCl, 1M MgCl2, 0.1% Tween-20 in distilled water). Counterstaining was performed with a BM-purple solution (Roche) at room temperature until signal detection. Finally, slides were washed in PBS and mounted in Aquatex mounting media (Merck Milipore, Germany). Microphotographs were taken with Leica light microscope with 20X magnification.



This work was supported by a PhD fellowship from the French Ministry of Education and Research to MT and grants from the Agence Nationale de la Recherche (ANR) to JNV.

Authors’ Affiliations

Institut de Génomique Fonctionnelle de Lyon, Ecole Normale Supérieure de Lyon, Centre National de la Recherche Scientifique UMR 5242, Université de Lyon I, Lyon Cedex 07, France
Physiologische Chemie, Biozentrum, University of Würzburg, Am Hubland, and Comprehensive Cancer Center, University Clinic Würzburg, Würzburg, Germany
Center for Medical Genomics, Department of Biology, Penn State University, University Park, USA


  1. Devlin RH, Nagahama Y: Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences. Aquaculture. 2002, 208: 191-364. 10.1016/S0044-8486(02)00057-1.View ArticleGoogle Scholar
  2. Kikuchi K, Hamaguchi S: Novel sex-determining genes in fish and sex chromosome evolution. Dev Dyn. 2013, 242: 339-353. 10.1002/dvdy.23927.View ArticlePubMedGoogle Scholar
  3. Kobayashi Y, Nagahama Y, Nakamura M: Diversity and plasticity of sex determination and differentiation in fishes. Sex Dev. 2012, 7: 115-125.View ArticlePubMedGoogle Scholar
  4. Volff JN, Nanda I, Schmid M, Schartl M: Governing sex determination in fish: regulatory putsches and ephemeral dictators. Sex Dev. 2007, 1: 85-99. 10.1159/000100030.View ArticlePubMedGoogle Scholar
  5. Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T, Morrey CE, Shibata N, Asakawa S, Shimizu N, Hori H, Hamaguchi S, Sakaizumi M: DMY is a Y-specific DM-domain gene required for male development in the medaka fish. Nature. 2002, 417: 559-563. 10.1038/nature751.View ArticlePubMedGoogle Scholar
  6. Nanda I, Kondo M, Hornung U, Asakawa S, Winkler C, Shimizu A, Shan Z, Haaf T, Shimizu N, Shima A, Schmid M, Schartl M: A duplicated copy of DMRT1 in the sex-determining region of the Y chromosome of the medaka, Oryzias latipes. Proc Natl Acad Sci U S A. 2002, 99: 11778-11783. 10.1073/pnas.182314699.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Myosho T, Otake H, Masuyama H, Matsuda M, Kuroki Y, Fujiyama A, Naruse K, Hamaguchi S, Sakaizumi M: Tracing the emergence of a novel sex-determining gene in medaka, Oryzias luzonensis. Genetics. 2012, 191: 163-170. 10.1534/genetics.111.137497.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Hattori RS, Murai Y, Oura M, Masuda S, Majhi SK, Sakamoto T, Fernandino JI, Somoza GM, Yokota M, Strüssmann CA: A Y-linked anti-Mullerian hormone duplication takes over a critical role in sex determination. Proc Natl Acad Sci U S A. 2012, 109: 2955-2959. 10.1073/pnas.1018392109.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Yano A, Guyomard R, Nicol B, Jouanno E, Quillet E, Klopp C, Cabau C, Bouchez O, Fostier A, Guiguen Y: An immune-related gene evolved into the master sex-determining gene in rainbow trout, Oncorhynchus mykiss. Curr Biol. 2012, 22: 1423-1428. 10.1016/j.cub.2012.05.045.View ArticlePubMedGoogle Scholar
  10. Kamiya T, Kai W, Tasumi S, Oka A, Matsunaga T, Mizuno N, Fujita M, Suetake H, Suzuki S, Hosoya S, Tohari S, Brenner S, Miyadai T, Venkatesh B, Suzuki Y, Kikuchi K: A trans-species missense SNP in Amhr2 is associated with sex determination in the tiger pufferfish, Takifugu rubripes (fugu). PLoS Genet. 2012, 8: e1002798-10.1371/journal.pgen.1002798.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Graham P, Penn JK, Schedl P: Masters change, slaves remain. Bioessays. 2003, 25: 1-4. 10.1002/bies.10207.View ArticlePubMedGoogle Scholar
  12. Schultheis C, Böhne A, Schartl M, Volff JN, Galiana-Arnoux D: Sex determination diversity and sex chromosome evolution in poeciliid fish. Sex Dev. 2009, 3: 68-77. 10.1159/000223072.View ArticlePubMedGoogle Scholar
  13. Froschauer A, Körting C, Katagiri T, Aoki T, Asakawa S, Shimizu N, Schartl M, Volff JN: Construction and initial analysis of bacterial artificial chromosome (BAC) contigs from the sex-determining region of the platyfish Xiphophorus maculatus. Gene. 2002, 295: 247-254. 10.1016/S0378-1119(02)00684-4.View ArticlePubMedGoogle Scholar
  14. Volff JN, Selz Y, Hoffmann C, Froschauer A, Schultheis C, Schmidt C, Zhou Q, Bernhardt W, Hanel R, Böhne A, Brunet F, Ségurens B, Couloux A, Bernard-Samain S, Barbe V, Ozouf-Costaz C, Galiana D, Lohse MJ, Schartl M: Gene amplification and functional diversification of melanocortin 4 receptor at an extremely polymorphic locus controlling sexual maturation in the platyfish. Genetics. 2013, 195: 1337-1352. 10.1534/genetics.113.155952.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Schartl M, Walter RB, Shen Y, Garcia T, Catchen J, Amores A, Braasch I, Chalopin D, Volff JN, Lesch KP, Bisazza A, Minx P, Hillier L, Wilson RK, Fuerstenberg S, Boore J, Searle S, Postlethwait JH, Warren WC: The genome of the platyfish, Xiphophorus maculatus, provides insights into evolutionary adaptation and several complex traits. Nat Genet. 2013, 45: 567-572. 10.1038/ng.2604.View ArticlePubMedPubMed CentralGoogle Scholar
  16. Volff JN, Körting C, Froschauer A, Zhou Q, Wilde B, Schultheis C, Selz Y, Sweeney K, Duschl J, Wichert K, Altschmied J, Schartl M: The Xmrk oncogene can escape nonfunctionalization in a highly unstable subtelomeric region of the genome of the fish Xiphophorus. Genomics. 2003, 82: 470-479. 10.1016/S0888-7543(03)00168-X.View ArticlePubMedGoogle Scholar
  17. Akoh CC, Lee GC, Liaw YC, Huang TH, Shaw JF: GDSL family of serine esterases/lipases. Prog Lipid Res. 2004, 43: 534-552. 10.1016/j.plipres.2004.09.002.View ArticlePubMedGoogle Scholar
  18. Lo YC, Lin SC, Shaw JF, Liaw YC: Crystal structure of the Escherichia coli thioesterase I/protease I/lysophospholipase L1: consensus sequence blocks constitute the catalytic center of SGNH-hydrolases through a conserved hydrogen bond network. J Mol Biol. 2003, 330: 539-551. 10.1016/S0022-2836(03)00637-5.View ArticlePubMedGoogle Scholar
  19. Kapitonov VV, Jurka J: Rolling-circle transposons in eukaryotes. Proc Natl Acad Sci U S A. 2001, 98: 8714-8719. 10.1073/pnas.151269298.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Thomas J, Schaack S, Pritham EJ: Pervasive horizontal transfer of rolling-circle transposons among animals. Genome Biol Evol. 2010, 2: 656-664. 10.1093/gbe/evq050.View ArticlePubMedPubMed CentralGoogle Scholar
  21. Du C, Caronna J, He L, Dooner HK: Computational prediction and molecular confirmation of Helitron transposons in the maize genome. BMC Genomics. 2008, 9: 51-10.1186/1471-2164-9-51.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Hollister JD, Gaut BS: Population and evolutionary dynamics of Helitron transposable elements in Arabidopsis thaliana. Mol Biol Evol. 2007, 24: 2515-2524. 10.1093/molbev/msm197.View ArticlePubMedGoogle Scholar
  23. Van den Hurk R, Peute J, Vermeij JAJ: Ultrastructural study of the testis of the black molly (Mollienisia latipinna) I. The intratesticular efferent duct system. Proc Kon Ned Akad Wet Ser. 1974, 77: 460-469.Google Scholar
  24. Molyneaux K, Wylie C: Primordial germ cell migration. Int J Dev Biol. 2004, 48: 537-544. 10.1387/ijdb.041833km.View ArticlePubMedGoogle Scholar
  25. Hasselmann M, Gempe T, Schiøtt M, Nunes-Silva CG, Otte M, Beye M: Evidence for the evolutionary nascence of a novel sex determination pathway in honeybees. Nature. 2008, 454: 519-522. 10.1038/nature07052.View ArticlePubMedGoogle Scholar
  26. Yoshimoto S, Okada E, Umemoto H, Tamura K, Uno Y, Nishida-Umehara C, Matsuda Y, Takamatsu N, Shiba T, Ito M: A W-linked DM-domain gene, DM-W, participates in primary ovary development in Xenopus laevis. Proc Natl Acad Sci U S A. 2008, 105: 2469-2474. 10.1073/pnas.0712244105.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Lampert KP, Schmidt C, Fischer P, Volff JN, Hoffmann C, Muck J, Lohse MJ, Ryan MJ, Schartl M: Determination of onset of sexual maturation and mating behavior by melanocortin receptor 4 polymorphisms. Curr Biol. 2010, 20: 1729-1734. 10.1016/j.cub.2010.08.029.View ArticlePubMedGoogle Scholar
  28. Ellegren H, Parsch J: The evolution of sex-biased genes and sex-biased gene expression. Nat Rev Genet. 2007, 8: 689-698. 10.1038/nrg2167.View ArticlePubMedGoogle Scholar
  29. Arai H, Koizumi H, Aoki J, Inoue K: Platelet-activating factor acetylhydrolase (PAF-AH). J Biochem. 2002, 131: 635-640. 10.1093/oxfordjournals.jbchem.a003145.View ArticlePubMedGoogle Scholar
  30. Hough SR, Parks JE: Platelet-activating factor acetylhydrolase activity in seminal plasma from the bull, stallion, rabbit, and rooster. Biol Reprod. 1994, 50: 912-916. 10.1095/biolreprod50.4.912.View ArticlePubMedGoogle Scholar
  31. Levine AS, Kort HI, Toledo AA, Roudebush WE: A review of the effect of platelet-activating factor on male reproduction and sperm function. J Androl. 2002, 23: 471-476.PubMedGoogle Scholar
  32. Scott BT, Olson N, Long GL, Bovill EG: Novel isoforms of intracellular platelet activating factor acetylhydrolase (PAFAH1b2) in human testis; encoded by alternatively spliced mRNAs. Prostaglandins Other Lipid Mediat. 2008, 85: 69-80. 10.1016/j.prostaglandins.2007.10.005.View ArticlePubMedPubMed CentralGoogle Scholar
  33. Yan W, Assadi AH, Wynshaw-Boris A, Eichele G, Matzuk MM, Clark GD: Previously uncharacterized roles of platelet-activating factor acetylhydrolase 1b complex in mouse spermatogenesis. Proc Natl Acad Sci U S A. 2003, 100: 7189-7194. 10.1073/pnas.1236145100.View ArticlePubMedPubMed CentralGoogle Scholar
  34. Zhu J, Massey JB, Mitchell-Leef D, Elsner CW, Kort HI, Roudebush WE: Platelet-activating factor acetylhydrolase activity affects sperm motility and serves as a decapacitation factor. Fertil Steril. 2006, 85: 391-394. 10.1016/j.fertnstert.2005.07.1303.View ArticlePubMedGoogle Scholar
  35. Bonin F, Ryan SD, Migahed L, Mo F, Lallier J, Franks DJ, Arai H, Bennett SA: Anti-apoptotic actions of the platelet-activating factor acetylhydrolase I alpha2 catalytic subunit. J Biol Chem. 2004, 279: 52425-52436. 10.1074/jbc.M410967200.View ArticlePubMedGoogle Scholar
  36. Tokuoka SM, Ishii S, Kawamura N, Satoh M, Shimada A, Sasaki S, Hirotsune S, Wynshaw-Boris A, Shimizu T: Involvement of platelet-activating factor and LIS1 in neuronal migration. Eur J Neurosci. 2003, 18: 563-570. 10.1046/j.1460-9568.2003.02778.x.View ArticlePubMedGoogle Scholar
  37. Kapitonov VV, Jurka J: The esterase and PHD domains in CR1-like non-LTR retrotransposons. Mol Biol Evol. 2003, 20: 38-46. 10.1093/molbev/msg011.View ArticlePubMedGoogle Scholar
  38. Zhou Q, Froschauer A, Schultheis C, Schmidt C, Bienert GP, Wenning M, Dettai A, Volff JN: Helitron transposons on the sex chromosomes of the platyfish Xiphophorus maculatus and their evolution in animal genomes. Zebrafish. 2006, 3: 39-52. 10.1089/zeb.2006.3.39.View ArticlePubMedGoogle Scholar
  39. Edgar RC: MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32: 1792-1797. 10.1093/nar/gkh340.View ArticlePubMedPubMed CentralGoogle Scholar
  40. Galtier N, Gouy M, Gautier C: SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Comput Appl Biosci. 1996, 12: 543-548.PubMedGoogle Scholar
  41. Gouy M, Guindon S, Gascuel O: SeaView version 4: A multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol Biol Evol. 2010, 27: 221-224. 10.1093/molbev/msp259.View ArticlePubMedGoogle Scholar
  42. Hall TA: BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999, 41: 95-98.Google Scholar
  43. Finn RD, Mistry J, Tate J, Coggill P, Heger A, Pollington JE, Gavin OL, Gunasekaran P, Ceric G, Forslund K, Holm L, Sonnhammer EL, Eddy SR, Bateman A: The Pfam protein families database. Nucleic Acids Res. 2010, 38: D211-D222. 10.1093/nar/gkp985.View ArticlePubMedPubMed CentralGoogle Scholar
  44. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, Issel-Tarver L, Kasarskis A, Lewis S, Matese JC, Richardson JE, Ringwald M, Rubin GM, Sherlock G: Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000, 25: 25-29. 10.1038/75556.View ArticlePubMedPubMed CentralGoogle Scholar
  45. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001, 25: 402-448. 10.1006/meth.2001.1262.View ArticlePubMedGoogle Scholar
  46. Øvergård AC, Nerland AH, Patel S: Evaluation of potential reference genes for real time RT-PCR studies in Atlantic halibut (Hippoglossus Hippoglossus L.) during development, in tissues of healthy and NNV-injected fish, and in anterior kidney leucocytes. BMC Mol Biol. 2010, 11: 11-36. 10.1186/1471-2199-11-11.View ArticleGoogle Scholar
  47. Zhang Z, Hu J: Development and validation of endogenous reference genes for expression profiling of medaka (Oryzias latipes) exposed to endocrine disrupting chemicals by quantitative Real-Time RT-PCR. Toxicol Sci. 2007, 95: 356-368.View ArticlePubMedGoogle Scholar


© Tomaszkiewicz et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited.
