RHD positive haplotypes in D negative Europeans

Wagner, Franz F; Frohmajer, Alexander; Flegel, Willy A

doi:10.1186/1471-2156-2-10

BMC Genomic Data

Table 4 Primers used

From: RHD positive haplotypes in D negative Europeans

		Genomic
Name	Nucleotide sequence	region	Position^*	Strandedness	specificity
ga31	ttgtcggtgctgatctcagtgga	exon 3	362 to 383	sense	RHD
ga41	acatgatgcacatctacgtgttcgc	exon 4	503 to 527	sense	RHD/RHCE
ga42	cagacaaactgggtatcgttgctg	exon 4	625 to 602	antisense	RHD/RHCE
ga51	ctgctcaccttgctgatcttccc	intron 5/exon.	5 8 to 787	antisense	RHD
ga61	caggtacttggctcccccgac	exon 6	936 to 916	antisense	RHD
ga62	ttatgtgcacagtgcggtgttgg	exon 6	804 to 826	sense	RHD/RHCE
ga71	gttgtaaccgagtgctggggattc	exon 7	944 to 967	sense	RHD/RHCE
ga72	tgccggctccgacggtatc	exon 7	1066 to 1048	antisense	RHD
rb12	tcctgaacctgctctgtgaagtgc	intron 4	198 to 175	antisense	RHD
rb21	aggtccctcctccagcac	intron 3	28 to 11	antisense	RHD/RHCE
rb24	agacctttggagcaggagtg	intron 4	-53 to -34	sense	RHD/RHCE
rb26	aggggtgggtagggaatatg	intron 6	-62 to -43	sense	RHD/RHCE
rb45	acactgttgrctgaatttcggtgc	intron 1	164 to 139	antisense	RHD/RHCE
rb51	gcatgacgtgttctgcctcttg	intron 7	-3365 to - 3386	antisense	RHD
rb52	ccaggttgttaagcattgctgtacc	intron 7	-3433 to -3409	sense	RHD
re04	aggtcacatccatttatcccactg	promoter	-2498 to -2474	sense	RHD/RHCE
re08	gggcttgggacttagttctaac	promoter	-858 to -879	antisense	RHD/RHCE
re09	cgactgggtgattaaaatctcc	promoter	-1280to-1259	sense	RHD/RHCE
re011d	gcagccaacttcccctgtg	promoter	-883 to -905	antisense	RHD
re012	tccactttccacctccctgc	promoter	-1148to-1122	sense	RHD
relld	agaagatgggggaatctttttcct	intron 1	129 to 106	antisense	RHD/RHCE
re41	cgatacccagtttgtctgccatgc	exon 4	608 to 631	sense	RHD/RHCE
re71	acccagcaagctgaagttgtagcc	exon 7	1,008 to 985	antisense	RHD
re74	tatccatgaggtgctgggaac	intron 7	-244 to -224	sense	RHD/RHCE
re721	ctggaggctctgagaggttgag	intron 7	-348 to -326	sense	RHD
re83	gagattaaaaatcctgtgctcca	intron 8	-54 to - 34	sense	RHD/RHCE
re93	cacccgcatgtcagactatttggc	intron 9	320 to 297	antisense	RHD/RHCE
re93k	gccaaatagtttgacatgcgggtg	intron 9	297 to 320	sense	RHD/RHCE
re94	cttggtcatcaaaatatttagcct	exon 9	1216 to 1193	antisense	RHD
re916	gtttttgaggcaaagtctcgctc	intron 9	1689 to 1666	antisense	RHD/RHCE
rea7	tgttgcctgcatttgtacgtgag	3' UTR^†	1311 to 1333	sense	RHD/RHCE
rend31k	cctccccaacccagacagaattag	AJ252311^‡	8506 to 8529	sense	not applicable
rend9b1	cactgcacttggcaccattgag	AL031432	29489 to 29468	antisense	not applicable
rend9b2	ttccgaaggctgcttttccc	AL031432	28840 to 28859	sense	not applicable
Rh152Tb	gatattactgatgaccatcctcatgg	exon3	480 to 455	antisense	RHCE
Rh223Vf	ttgtggatgttctggccaagtg	exon 5	646 to 667	sense	RHCE
Rh245Vb	gctgtcaccactctgactgctac	exon5	755 to 733	antisense	RHD
RhPsiB	tctgatctttatcctccgttccctc	exon 4	601 to 577	antisense	RHD
RhPsiF	agacagactaccacatgaacttac	intron 3	-38 to-15	sense	RHDψ
RhX1f1	cgctgcctgcccctctga	exon 1	31 to 48	sense	RHD(W16X)
rr4	agcttactggatgaccacca	3'UTR	1,541 to 1,522	antisense	RHD

^*The positions of the synthetic oligonucleotides are indicated relative to their distances from the first nucleotide position of the start codon ATG for all primers in the promoter and in the exons including the 3' untranslated part of exon 10, relative to their adjacent exon/intron boundaries of RHCE for primers in introns; and according to the numbering in the genomic sequences indicated. Primers rh1 [44], ga31 (previously dubbed D-3-383), ga41 (D-4-527), ga42 (D-4-602), ga51 (D-5-787), ga61 (D-6-916), ga62 (D-6-826), ga71 (D-7-967), ga72 (D-7-1048) [27], rb5, rb12, rb24, rh5, rh7 [31], rb21, rb26, re11d, re71, re74, re83, re93, rr4 [32], re012 [29], re011d and rea7 [7] have been published previously. ^† 5' UTR: 5' untranslated region of exon 1; 3' UTR: 3' untranslated region of exon 10. ^‡ Accession number of nucleic acid sequence in EMBL/GenBank/DDBJ; AJ252311 represents upstream Rhesus box; AL031431 Chromosome 1 genomic clone dJ465N24.

Back to article page

ISSN: 2730-6844

Contact us

General enquiries: journalsubmissions@springernature.com