Skip to main content

Advertisement

Table 2 Oligonucleotide pairs used in the amplification and sequencing

From: Major genomic mitochondrial lineages delineate early human expansions

    Fragment Annealing
Name CRS reference Sequence (5'–3') size (pb) temp.(°C)
L16340 (16318–16340) AGCCATTTACCGTACATAGCACA 681 52
H408 (429–408) TGTTAAAAGTGCATACCGCCA   
L382 (362–382) CAAAGAACCCTAACACCAGCC 603 56
H945 (964–945) GGGAGGGGGTGATCTAAAAC   
L923 (902–923) GTCACACGATTAACCCAAGTCA 607 56
H1487 (1508–1487) GTATACTTGAGGAGGGTGACGG   
L1466 (1445–1466) GAGTGCTTAGTTGAACAGGGCC 629 58
H2053 (2073–2053) TTAGAGGGTTCTGTGGGCAAA   
L2025 (2004–2025) GCCTGGTGATAGCTGGTTGTCC 609 52
H2591 (2612–2591) GGAACAAGTGATTATGCTACCT   
L2559 (2538–2559) CACCGCCTGCCCAGTGACACAT 591 56
H3108 (3128–3108) TCGTACAGGGAGGAATTTGAA   
L3073 (3051–3073) AAAGTCCTACGTGATCTGAGTTC 640 52
H3670 (3690–3670) GGCGTAGTTTGAGTTTGATGC   
L3644 (3625–3644) GCCACCTCTAGCCTAGCCGT 623 58
H4227 (4247–4227) ATGCTGGAGATTGTAATGGGT   
L4210 (4189–4210) CCACTCACCCTAGCATTACTTA 625 55
H4792 (4813–4792) ACTCAGAAGTGAAAGGGGGCTA   
L4750 (4729–4750) CCAATACTACCAATCAATACTC 599 52
H5306 (5327–5306) GGTGATGGTGGCTATGATGGTG   
L5278 (5259–5278) TGGGCCATTATCGAAGAATT 593 58
H5832 (5851–5832) GACAGGGGTTAGGCCTCTTT   
L5781 (5762–5781) AGCCCCGGCAGGTTTGAAGC 626 58
H6367 (6387–6367) TGGCCCCTAAGATAGAGGAGA   
L6337 (6318–6337) CCTGGAGCCTCCGTAGACCT 601 58
H6899 (6918–6899) GCACTGCAGCAGATCATTTC   
L6869 (6850–6869) CCGGCGTCAAAGTATTTAGC 578 58
H7406 (7427–7406) GGGTTCTTCGAATGTGTGGTAG   
L7379 (7358–7379) AGAAGAACCCTCCATAAACCTG 580 56
H7918 (7937–7918) AGATTAGTCCGCCGTAGTCG   
L7882 (7861–7882) TCCCTCCCTTACCATCAAATCA 506 56
H8345 (8366–8345) TTTCACTGTAAAGAGGTGTTGG   
L8299 (8280–8299) ACCCCCTCTAGAGCCCACTG 603 56
H8861 (8882–8861) GAGCGAAAGCCTATAATCACTG   
L8799 (8779–8799) CTCGGACTCCTGCCTCACTCA 638 58
H9397 (9416–9397) GTGGCCTTGGTATGTGCTTT   
L9362 (9342–9362) GGCCTACTAACCAACACACTA 609 56
H9928 (9950–9928) AACCACATCTACAAAATGCCAGT   
L9886 (9865–9886) TCCGCCAACTAATATTTCACTT 617 56
H10462 (10481–10462) AATGAGGGGCATTTGGTAAA   
L10403 (10383–10403) AAAGGATTAGACTGAACCGAA 612 56
H10975 (10994–10975) CCATGATTGTGAGGGGTAGG   
L10949 (10930–10949) CTCCGACCCCCTAACAACCC 617 58
H11527 (11546–11527 CAAGGAAGGGGTAGGCTATG   
L11486 (11467–11486 AAAACTAGGCGGCTATGGTA 629 56
H12076 (12095–12076 GGAGAATGGGGGATAGGTGT   
L12028 (12008–12028 GGCTCACTCACCCACCACATT 615 58
H12603 (12623–12603 ACGAACAATGCTACAGGGATG   
L12572 (12553–12572 ACAACCCAGCTCTCCCTAAG 591 56
H13124 (13143–13124 ATTTTCTGCTAGGGGGTGGA   
L13088 (13068–13088 AGCCCTACTCCACTCAAGCAC 618 58
H13666 (13685–13666 AGGGTGGGGTTATTTTCGTT   
L13612 (13593–13612 AAGCGCCTATAGCACTCGAA 614 56
H14186 (14206–14186 TGGTTGAACATTGTTTGTTGG   
L13612 (13593–13612 AAGCGCCTATAGCACTCGAA 614 56
H14186 (14206–14186 TGGTTGAACATTGTTTGTTGG   
L14125 (14104–14125 TCTTTCTTCTTCCCACTCATCC 602 58
H14685 (14705–14685 CATTGGTCGTGGTTGTAGTCC   
L14650 (14629–14650 CCCCATTACTAAACCCACACTC 604 58
H15211 (15232–15211 TTGAACTAGGTCTGTCCCAATG   
L15162 (15143–15162 CTCCCGTGAGGCCAAATATC 597 58
H15720 (15739–15720 GTCTGCGGCTAGGAGTCAAT   
L15676 (15657–15676 TCCCCATCCTCCATATATCC 524 56
H16157 (16180–16157 TGATGTGGATTGGGTTTTTATGTA   
L15996 (15975–15996 CTCCACCATTAGCACCCAAAGC 446 58
H16401 (16420–16401 TGATTTCACGGAGGATGGTG