Skip to main content

Table 2 Primers for amplification of UNC93A genomic DNA.

From: The human homologue of unc-93 maps to chromosome 6q27 – characterisation and analysis in sporadic epithelial ovarian cancer

EXON PRIMER NAME PRIMER SEQUENCE (5'-3') PCR PRODUCT SIZE (BP) ANNEALING TEMPERATURE AND MG++ IN DHPLC DENATURING TEMPERATURE (°C) IN DHPLC GRADIENT START (INITIAL Buffer B%)
1 1f GAATGGGACTTCTTGGTACTGATTG 225 61° C, 1 mM 59 52
  1r TTCAGGTAATTTGATGACCGGACACA     
2 2f CTGTGCTCTGACAGGGCTGGCTTTGT 244 62° C, 1.5 mM 65 52
  2r GGGTGGGCAGGGGGTGGTGGCTGCT     
3 3f CTATGGGTCTGCATTTTACCC 282 61° C, 1.5 mM 61 54
  3r ACAATTGCTTGCCCCTTTTCCTTT     
4 4f ATTTGCCGTCATCTCATGTCT 195 61° C, 2 mM - -
  4r CTGCCCTGGGCCGATGGAGCTCGT     
5 5f TGAAAGCTGAAGCCTTTGCTATGT 276 61° C, 1.5 mM 60 55
  5r GAGCCACCGGCCCTCACTTTCGTT     
6 6f GCCTGGGAGCGTCCATGACGTGGC 204 61° C, 1.5 mM - -
  6r GGATGGGACCCACGCTGATACCTA     
7 7f TCCCCTCTGCACCCCCAGGCGCGG 167 61° C, 2 mM - -
  7r CTGGGCTGGGGACTCACCATTGTT     
8 a 8f TCACTCCGCTCTCTCCTCTGCAGC 166 58° C, 1.5 mM - -
  8r2 GACCCCCAGCAGAATGTAGAGCTT     
8b 8f2 AAGCTCTACATTCTGCTGGGGGTC 173 58° C, 1.5 mM - -
  8r TTCATCCTCCTCGGACCTCACTGCTCT     
8 8f TCACTCCGCTCTCTCCTCTGCAGC 315 62° C, 1 mM 63 55
  8r TTCATCCTCCTCGGACCTCACTGCTCT