Skip to main content

Table 2 Oligonucleotide primers used for PCR amplification, sequencing and screening in this study.

From: ABO exon and intron analysis in individuals with the AweakB phenotype reveals a novel O1v-A2 hybrid allele that causes four missense mutations in the A transferase

Primer name F/R* Nucleotide sequence (5' → 3') Position Function
mo-21s F1–3 GGTGAGAGAAGGAGGGTGAG intron 1 amplification-sequencing of intron 2 for all alleles
mo-31r R1,4 CCAGCACCCCGGCCAGCA intron 3 amplification-sequencing of intron 2 /screening of 46G>A
ABO-46A-F F4 CCAGGAAAACCAAAATGCCACA exon 2 screening of 46G>A
ABO-106G-R R2 TAGACTTCTGGGGCTTAGGAC exon 3 amplification of O2 allele in intron 2
ABO-106T-R R3 AGACTTCTGGGGCTTAGGAAC exon 3 amplification of new hybrid allele in intron 2
ABO-inII-123F F GTTATCAGGGTCCTAAGGACAG intron 2 sequencing of intron 2
ABO-inII-660R R CTGCCTGTTGGTCCCTTCCTC intron 2 sequencing of intron 2
ABO-133s F5–8 GCCCCAGAAGTCTAATGCCAG exon 3 amplification-sequencing of introns 3 and 4
ABO-202 cons-R R5 GGGAGGCACTGACATTATACC intron 4/exon 4 amplification-sequencing of intron 3 (except O2, B and hybrid alleles**)
ABO-188A-R R6,9 ATACCTTGGCAACGAGACGT intron 4/exon 4 amplification-sequencing of hybrid allele in intron 3 and screening
ABO-220 T-R R7,10 CCACGGTGTCAGCACCTTTGA exon 5 amplification-sequencing of O2 allele in introns 3 and 4
ABO-220 C-R R8,11 CACGGTGTCAGCACCTTTGG exon 5 amplification-sequencing of B allele in introns 3 and 4
ABO-inIII-F F9 GCTGGCCGTTACAGGGTCTG intron 3 screening of 188G>A mutation in exon 4
ABO-inIII-425F F GCTGCCCTCATCTCTGTGACA intron 3 sequencing of intron 3
ABO-inIII-672F F GTGCTATGGCCTCTGTTGGG intron 3 sequencing of intron 3
ABO-inIII 916F F CTCTGGCAGTTGATGCTGGC intron 3 sequencing of intron 3
mo-41s F10,11 TAAATCCTGCTCCTAGACTAAAC intron 3 amplification-sequencing of intron 4
ABO-inIV 170F F GACTTGGCCCTCGTCCTGCA intron 4 sequencing of intron 4
ABO-inIV-429R R GACTAGCCTGGCCAACATGG intron 4 sequencing of intron 4
ABO-inIV-852F F TAGCAACTCCATTTTCCCTCCC intron 4 sequencing of intron 4
ABO-inIV 877R R GTTGGAGTAGCAGACTCATAACA intron 4 sequencing of intron 4
ABO-inIV 1122F F CTCCTGAGCCTCTACAATCCT intron 4 sequencing of intron 4
ABO-inIV 1411F F CTCTACGTCCCTCCCAGCCT intron 4 sequencing of intron 4
ABO-229F F12,13 CTACCCCCAGCCAAAGGTGC exon 5 amplification-sequencing of all alleles in intron 5
ABO-297A-R R12 GTTGAGGATGTCGATGTTGAAT exon 6 amplification-sequencing of A1, A2, O1 and hybrid allele in intron 5
ABO-297G-R R13 GTTGAGGATGTCGATGTTGAAC exon 6 amplification-sequencing of B, O1vand O2 alleles in intron 5
mo-101s F4,9 CCGTCCGCCTGCCTTGCAG intron 6 internal control primer pair in screening
EPB-79R R4,9 TACTTGTTCAGGTGGCTCTCGTC exon 7 internal control primer pair in screening
  1. * Forward/reverse primer. ** O2, B and hybrid alleles were examined in heterozygous samples. The numeral superscripts denote primer combinations. Primers with the same number were used in the same primer mixes for amplification of ABO gene fragments.