Skip to main content

Advertisement

Table 1 Information about the 37 SNPs in the eight genes

From: Patterns of linkage disequilibrium and haplotype distribution in disease candidate genes

SNP Gene dbSNP accession polymor phisma Domain Distanceb Frequency (%)c Forward Primer Reverse Primer
1 APOE ss12568587 G-C 5' UTR   35.7 TCCCCAGGAGCCGGTGA CCCCAAGCCCGACCCC
2 APOE ss12568609 G-A Intron 2 1,277 39.9 CCTCAGGTGATCTGCCCGTTTC ACTCCTGGGCTCAAGTGATCCTC
3 APOE ss12568607 T-C Exon 4 1,497 14.9 CGGGCACGGCTGTCCAA CGAGCATGGCCTGCACCTC
4 APOE ss12568612 C-T Exon 4 138 8.7 GCTGCGTAAGCGGCTCC GCGGCCCTGTTCCACC
5 COL1A1 ss12568606 G-T 5' UTR   15.4 GCACCCTGCCCTAGACCAC CCTAGTGCCAGCGACTGCA
6 COL1A1 ss12568597 G-T Intron 1 3,543 18.8 CCAATCAGCCGCTCCCATTC CATCGGGAGGGCAGGCTC
7 COL1A1 ss12568598 G-T Exon 8 2,365 0.0 GGAAGACTGGGATGAGGGCA GGCTCGCCAGGCTCACC
8 COL1A1 ss12568584 G-A Exon 45 9,862 1.9 CTCAGCCTTCCCTGGCCAA AGGCGGAAGTTCCATTGGCATC
9 ER-α ss12568579 A-G Exon 1   48.4 TTGAGCTGCGGACGGTTCA CGCCGGTTTCTGAGCCTTC
10 ER-α ss12568596 T-C Intron 1 34,258 44.9 TGGGATTCCAGGCATGAACCAC TGGCGTCGATTATCTGAATTTGGCC
11 ER-α ss12568619 G-A Intron 3 66,110 25.7 CCCAGAAACAAGTCATCTGCTATTGACA GTAACAAAAGGTTAACAATGGTTAGCCC
12 ER-α ss12568618 G-C Exon 4 36,077 21.8 ACAGCCTGGCCTTGTCCC CAGGTTGGTCAGTAAGCCCATCA
13 ER-α ss12568585 G-A Intron 4 39,074 9.8 GATCAATGAAGTGGGTCTTGAAAAACCAA GGTGACAAGCTGGAAATCTAAGCTTCA
14 ER-α ss12568605 G-A Intron 6 83,068 11.9 GGAACGGCCCTTGGAAATTGTAAA CTGCCTACAGAATACAGTCAGCCA
15 ER-α ss12568617 G-A Exon 8 32,431 20.3 TCGCATTCCTTGCAAAAGTATTACATCAC CAAGCAAATGAATGGCCACTCATCTAGAAA
16 LEPR ss12568615 A-G Exon 4   29.0 AGATTTAAGTTGTCTTGCATGCCACC TTAAGCCCAGCATCCATTAGCTATTCTTTC
17 LEPR ss12568604 G-C Exon 14 3,013 18.2 GAGTAATTGGAGCAATCCAGCCTACA GCTTCAGCCACTGTACATCTTAGCTC
18 LEPR ss12568614 G-A Exon 20 62,803 35.3 GCCACGCTGATCAGCAACTC CCCTTGACTTGTCAGTCAAAAGCAC
19 PTHR1 ss12568589 G-A Intron 1   0.1 GACTTACATTAGGATTCAAGGTTACTGCCA GGGACGCAAGCCTGAGTCC
20 PTHR1 ss12568592 A-G Intron 2 4,250 39.8 GCAGAACCCTAAGGGCTTGTCA GGCGGGACCCAGGATACA
21 PTHR1 ss12568591 C-T Intron 8 5,436 37.4 CGAGCCTCAATTCAGGTGAATCTAACC CCCGCCCCAAGTGGAACA
22 PTHR1 ss12568588 G-A Intron 10 1,912 39.7 CCTTGAGCCCTTGGTTTTCCTTTC GCTCCGGGAACAAAAAGTGGATCA
23 PTHR1 ss12568590 G-A Exon 13 1,246 38.0 CTACAAGGCTCAAATTGCCCCAAA TTGGCGTCCACTACATTGTCTTCA
24 TGF-β1 ss12568613 C-T 5' UTR   31.1 GGGCCCAGTTTCCCTATCTGTAAA CTGGGCCACCGTCCTCATC
25 TGF-β1 ss12568603 +C/-C Intron 4 12,354 2.1 CCACGCCCCACTTATCTATCCC GGAAAGGCCGGTTCATGCCA
26 TGF-β1 ss12568593 C-T Exon 5 83 0.8 CAGGCTACAAGGCTCACCTGAA GGTTCACTACCGGCCGC
27 TGF-β1 ss12568602 C-T Intron 5 9,644 27.4 GGCTTGTCTTAAGCATTGCGTGAAATTAA GTACAGCTGCCGCACGC
28 UCP3 ss12568601 C-T 5' UTR   26.5 CACTGCCCTCACCAGCCA GTGAGTCCTGCCACGGCA
29 UCP3 ss12568600 G-A Exon 2 2,122 0.0 GCCCTAAAGGGACTGGGCA GAAAGGTAACGAGGTCAGCAAAACA
30 UCP3 ss12568595 T-C Exon 3 809 25.8 TGATTCCCGTAACATCTGGACTTTCATC CTGCCTAAATCCCCTTAGCAGAAAAAAAAA
31 UCP3 ss12568580 T-C Exon 5 1,712 44.7 CCTAACAGGAACTTTGCCCAACATCA TCCACGGAGTTCTGGGTTCC
32 UCP3 ss12568599 C-T Exon 7 2,996 0.0 CCTAACAGGAACTTTGCCCAACATCA TCCACGGAGTTCTGGGTTCC
33 VDR ss12568583 G-A 5' UTR   28.1 CAGCATGCCTGTCCTCAGC CCAGTACTGCCAGCTCCCA
34 VDR ss12568581 C-T Exon 2 4,818 37.3 TGGCCCTGGCACTGACTC GGCACGTTCCGGTCAAAGTC
35 VDR ss12568582 C-T Exon 4 21,590 0.0 GGACAGTCTGCGGCCCA CCCTACTCCCTGGGCCC
36 VDR ss12568610 G-A Intron 8 11,470 41.9 GTGCCCCTCACTGCCCTTA CCTCAAATAACAGGAATGTTGAGCCCA
37 VDR ss12568608 T-C Exon 9 1,078 40.8 GGGCCAGGCAGTGGTATCAC AGGTCGGCTAGCTTCTGGATCA
  1. a: Minor alleles are given in italic. b: Distance from the previous SNP within each gene in the unit of bp. c: Frequency of minor allele