Skip to main content

Advertisement

Table 1 Summary information about the studied SNPs

From: Current limitations of SNP data from the public domain for studies of complex disorders: a test for ten candidate genes for obesity and osteoporosis

SNPa Geneb Namec dbSNP Accession Mutationd Domain Minor allele frequency Forward primer Reverse primer
1 APOE   ss12568587 G-C 5' UTR 0.357 TCCCCAGGAGCCGGTGA CCCCAAGCCCGACCCC
2 APOE   ss12568609 G-A Intron 2 0.399 CCTCAGGTGATCTGCCCGTTTC ACTCCTGGGCTCAAGTGATCCTC
3 APOE   ss12568607 T-C Exon 4 0.149 CGGGCACGGCTGTCCAA CGAGCATGGCCTGCACCTC
4 APOE   ss12568612 C-T Exon 4 0.087 GCTGCGTAAGCGGCTCC GCGGCCCTGTTCCACC
5 COL1α1   ss12568606 G-T 5' UTR 0.154 GCACCCTGCCCTAGACCAC CCTAGTGCCAGCGACTGCA
6 COL1α1 Sp1 ss12568597 G-T Intron 1 0.188 CCAATCAGCCGCTCCCATTC CATCGGGAGGGCAGGCTC
7 COL1α1   ss12568598 G-T Exon 8 0.000 GGAAGACTGGGATGAGGGCA GGCTCGCCAGGCTCACC
8 COL1α1   ss12568584 G-A Exon 45 0.019 CTCAGCCTTCCCTGGCCAA AGGCGGAAGTTCCATTGGCATC
9 ER-α   ss12568579 A-G Exon 1 0.484 TTGAGCTGCGGACGGTTCA CGCCGGTTTCTGAGCCTTC
10 ER-α Pvu II ss12568596 T-C Intron 1 0.449 TGGGATTCCAGGCATGAACCAC TGGCGTCGATTATCTGAATTTGGCC
11 ER-α   ss12568619 G-A Intron 3 0.257 CCCAGAAACAAGTCATCTGCTATTGACA TGTAACAAAAGGTTAACAATGGTTAGCCC
12 ER-α   ss12568618 G-C Exon 4 0.218 ACAGCCTGGCCTTGTCCC CAGGTTGGTCAGTAAGCCCATCA
13 ER-α   ss12568585 G-A Intron 4 0.098 GATCAATGAAGTGGGTCTTGAAAAACCAA GGTGACAAGCTGGAAATCTAAGCTTCA
14 ER-α   ss12568605 G-A Intron 6 0.119 GGAACGGCCCTTGGAAATTGTAAA CTGCCTACAGAATACAGTCAGCCA
15 ER-α   ss12568617 G-A Exon 8 0.203 TCGCATTCCTTGCAAAAGTATTACATCAC CAAGCAAATGAATGGCCACTCATCTAGAAA
16 IL-6   ss12568616 C-G 5' UTR 0.434 GGGCAGAATGAGCCTCAGACATC GACATGCCAAAGTGCTGAGTCACTAATA
17 IL-6   ss12568586 A-T Exon 4 0.005 CCTCCACTGCAAAGGATTTATTCAACA CATGTCCTGCAGCCACTGGTTC
18 LEPR   ss12568615 A-G Exon 4 0.290 AGATTTAAGTTGTCTTGCATGCCACC TTAAGCCCAGCATCCATTAGCTATTCTTTC
19 LEPR   ss12568604 G-C Exon 14 0.182 GAGTAATTGGAGCAATCCAGCCTACA GCTTCAGCCACTGTACATCTTAGCTC
20 LEPR   ss12568614 G-A Exon 20 0.353 GCCACGCTGATCAGCAACTC CCCTTGACTTGTCAGTCAAAAGCAC
21 PTHR1   ss12568589 G-A Intron 1 0.001 GACTTACATTAGGATTCAAGGTTACTGCCA GGGACGCAAGCCTGAGTCC
22 PTHR1   ss12568592 A-G Intron 2 0.398 GCAGAACCCTAAGGGCTTGTCA GGCGGGACCCAGGATACA
23 PTHR1   ss12568591 C-T Intron 8 0.374 CGAGCCTCAATTCAGGTGAATCTAACC CCCGCCCCAAGTGGAACA
24 PTHR1   ss12568588 G-A Intron 10 0.397 CCTTGAGCCCTTGGTTTTCCTTTC GCTCCGGGAACAAAAAGTGGATCA
25 PTHR1   ss12568590 G-A Exon 13 0.380 CTACAAGGCTCAAATTGCCCCAAA TTGGCGTCCACTACATTGTCTTCA
26 TGF-β1   ss12568613 C-T 5' UTR 0.311 GGGCCCAGTTTCCCTATCTGTAAA CTGGGCCACCGTCCTCATC
27 TGF-β1   ss12568603 +C/-C Intron 4 0.021 CCACGCCCCACTTATCTATCCC GGAAAGGCCGGTTCATGCCA
28 TGF-β1   ss12568593 C-T Exon 5 0.008 CAGGCTACAAGGCTCACCTGAA GGTTCACTACCGGCCGC
29 TGF-β1   ss12568602 C-T Intron 5 0.274 GGCTTGTCTTAAGCATTGCGTGAAATTAA GTACAGCTGCCGCACGC
30 TNFR2   ss12568594 T-C 5' UTR 0.000 TGCACTCGGCCTGTTTAGACTC CTGTTCATCTGCCCCCTGCC
31 TNFR2   ss12568611 T-G Exon 6 0.198 AGCCACCCCAGCCACTC GCTTGGAGCAGTGCTGGGTTC
32 UCP3   ss12568601 C-T 5' UTR 0.265 CACTGCCCTCACCAGCCA GTGAGTCCTGCCACGGCA
33 UCP3   ss12568600 G-A Exon 2 0.000 GCCCTAAAGGGACTGGGCA GAAAGGTAACGAGGTCAGCAAAACA
34 UCP3   ss12568595 T-C Exon 3 0.258 TGATTCCCGTAACATCTGGACTTTCATC CTGCCTAAATCCCCTTAGCAGAAAAAAAAA
35 UCP3   ss12568580 T-C Exon 5 0.447 CCTAACAGGAACTTTGCCCAACATCA TCCACGGAGTTCTGGGTTCC
36 UCP3   ss12568599 C-T Exon 7 0.000 CCTAACAGGAACTTTGCCCAACATCA TCCACGGAGTTCTGGGTTCC
37 VDR   ss12568583 G-A 5' UTR 0.281 CAGCATGCCTGTCCTCAGC CCAGTACTGCCAGCTCCCA
38 VDR Fok I ss12568581 C-T Exon 2 0.373 TGGCCCTGGCACTGACTC GGCACGTTCCGGTCAAAGTC
39 VDR   ss12568582 C-T Exon 4 0.000 GGACAGTCTGCGGCCCA CCCTACTCCCTGGGCCC
40 VDR Bsm I ss12568610 G-A Intron 8 0.419 GTGCCCCTCACTGCCCTTA CCTCAAATAACAGGAATGTTGAGCCCA
41 VDR Taq I ss12568608 T-C Exon 9 0.408 GGGCCAGGCAGTGGTATCAC AGGTCGGCTAGCTTCTGGATCA
  1. aDesignation in the present study. bAbbreviations: APOE, apolipoprotein E; COL1α1, collagen type I α1; ER-α, estrogen receptor-α; IL-6, interleukin-6; LEPR, leptin receptor; PTHR1, parathyroid hormone (PTH)/PTH-related peptide receptor type 1; TGF-α1, transforming growth factor-ß1; TNFR2, tumor necrosis factor receptor 2; UCP3, uncoupling protein 3; VDR, vitamin D (1,25-dihydroxyvitamin D3) receptor. cCommon name. dMinor alleles are given in bold.