Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used for selecting the PAC clones from TAIGP714 large-insert library

From: Targeted oligonucleotide-mediated microsatellite identification (TOMMI) from large-insert library clones

PAC Clone Gene/Marker Forward Primer (5'-3')
Reverse Primer (5'-3')
Size (bp) References
TAIGP714M09100Q GUSB GTCTGTGTCTGACTTCTACACTCTC
GCGGTCACAGGCTGCATCACCT
504 [24]
TAIGP714N07113Q HEXB GGAAGCTATTCTTTGTCTCATGT
CTTTTCCCCAAGACCGTGAAT
132 [25]
TAIGP714I04060Q CALCA CCCTCACTCTTACCTCTAACC
AGCTAAGCGGTGCAGTAATC
398 [26]
TAIGP714P05202Q HoxA10 CAGCCAACTGGCTCACGGCA
AGTTGGCTGTGAGCTCCCGG
239 [27]
TAIGP714O11196Q HYAL3 GATTGGGAGGAGTGGTGTC
GAGGTAGATGCTGGGGAAG
363 [28]
TAIGP714I22103Q SPRMTK GCGAGATGACATGACTGTCT
CTGTACCCATGGCACGCACA
254 [29]
TAIGP714F10061Q SW813 TCAGTTATTTCTGGCTATCATCTC
TTGATGTAGACCACCCAGCTAGTG
98–114 [12]
TAIGP714L02061Q S0111 AGTTGATTTAAAATGTTGTGCCA
AATATTTCAAAAAAAGGAATGCG
150–178 [10]
TAIGP714I23038Q SW742 AATTCTACTTCTGGGGAGAGGG
CTTTTGGGAACATTTCTGCC
193–227 [11]
TAIGP714N18001Q LAMR1P1 GTCGTAACTTAAAGGGAG
ATTTGGAAGTCAAGGTTGG
128 unpublished
TAIGP714H02175Q PGK1 CTTCCATCCCAAGCATC
TTCCCTTCTTCCTCCAC
384 [30]