Skip to main content

Advertisement

Table 1 Primers used for selecting the PAC clones from TAIGP714 large-insert library

From: Targeted oligonucleotide-mediated microsatellite identification (TOMMI) from large-insert library clones

PAC Clone Gene/Marker Forward Primer (5'-3') Reverse Primer (5'-3') Size (bp) References
TAIGP714M09100Q GUSB GTCTGTGTCTGACTTCTACACTCTC GCGGTCACAGGCTGCATCACCT 504 [24]
TAIGP714N07113Q HEXB GGAAGCTATTCTTTGTCTCATGT CTTTTCCCCAAGACCGTGAAT 132 [25]
TAIGP714I04060Q CALCA CCCTCACTCTTACCTCTAACC AGCTAAGCGGTGCAGTAATC 398 [26]
TAIGP714P05202Q HoxA10 CAGCCAACTGGCTCACGGCA AGTTGGCTGTGAGCTCCCGG 239 [27]
TAIGP714O11196Q HYAL3 GATTGGGAGGAGTGGTGTC GAGGTAGATGCTGGGGAAG 363 [28]
TAIGP714I22103Q SPRMTK GCGAGATGACATGACTGTCT CTGTACCCATGGCACGCACA 254 [29]
TAIGP714F10061Q SW813 TCAGTTATTTCTGGCTATCATCTC TTGATGTAGACCACCCAGCTAGTG 98–114 [12]
TAIGP714L02061Q S0111 AGTTGATTTAAAATGTTGTGCCA AATATTTCAAAAAAAGGAATGCG 150–178 [10]
TAIGP714I23038Q SW742 AATTCTACTTCTGGGGAGAGGG CTTTTGGGAACATTTCTGCC 193–227 [11]
TAIGP714N18001Q LAMR1P1 GTCGTAACTTAAAGGGAG ATTTGGAAGTCAAGGTTGG 128 unpublished
TAIGP714H02175Q PGK1 CTTCCATCCCAAGCATC TTCCCTTCTTCCTCCAC 384 [30]