Skip to main content

Advertisement

Table 2 Forward and reverse sequencing primer

From: Targeted oligonucleotide-mediated microsatellite identification (TOMMI) from large-insert library clones

   Single reverse sequencing primer
Locus Initial sequencing primer (5'-3') Primer sequence (5'-3') Primer location (GenBank)
S0701 (CA)8T CCCAGGAGATTGAATATAG 223–241 (AY253989)
S0702 (CA)8A AAAAGCACCCAAAAAAGCC 156–174 (AY253990)
S0703 (CA)8T CTTATGGAGGTTCTCAGG 55–72 (AY253991)
S0704 (CA)8A GAGTGTGGGATAGACTG 119–135 (AY253992)
S0705 (CA)8G GAAGGGTAGGTTAAAGGG 252–269 (AY253993)
S0706 (CA)8G GGGAAACAGAAAATGGGG 156–173 (AY253994)
S0707 (AC)8G GTGAGCAAATAATTCAGTG 116–134 (AY253995)
S0708 (AC)8T CACAATTACTGCTTCTCTC 77–95 (AY253996)
S0709 (AC)8C GAGTGAGCACCATTCTAAG 117–135 (AY253997)
S0710 (CA)8A GCTTCATCACCCTGTTC 61–77 (AY253998)
S0711 (AC)8T CATTTTTCAGAGGGAAGAG 86–104 (AY253999)
S0712 (CA)8G GACCCTGGCATAGTATC 254–270 (AY254000)
S0713 (CA)8AT GAAGATACTGTTCTATGGATAG 1–22 (AY254001)
S0714 (CA)8GC CGTGTAGGTTGAAGACAAG 123–141 (AY254002)
S0715 (AC)8G GAGTTGTGTTTTATGGAGTTG 43–63 (AY254003)
S0766 (CA)8G AGACCTCCTATTAGAGGTGGA 519–539 (AY731063)
S0767 (CA)8T CTAGAATGGAAAACAATCTGA 367–387 (AY731064)