Skip to main content

Advertisement

Table 3 Characteristics of TOMMI-microsatellites

From: Targeted oligonucleotide-mediated microsatellite identification (TOMMI) from large-insert library clones

PAC Locus Chr1) Primer pair sequence (5'-3') Ta Size range Alleles NE PIC HT Repeat motif GenBank
TAIGP714M09100Q S0701 3p16-p14 GCAGAGTGATTCAGTTATAC 60 366–372 3 1.89 0.38 0.47 i(GT)14i(AT)6 AY253989
    TCATCTTCCCTACCACC         
TAIGP714M09100Q S0702 3p16-p14 TTTGGGGGGTTTGTTTTTG 57 346–348 2 1.18 0.14 0.16 (GT)9 AY253990
    AATATAATTGGTGGCTCGG         
TAIGP714N07113Q S0703 2p13-p11 AACCCACTGAACAAGGC 58 239–259 7 3.37 0.70 0.70 i(GT)11(AT)9 AY253991
    GCAAGACAGATACTACAGG         
TAIGP714N07113Q S0704 2p13-p11 AGCTATCATCAGGAAATGC 58 265–285 11 5.34 0.81 0.81 (GT)18 AY253992
    GTTCTGTCGATTTTCTACTG         
TAIGP714I04060Q S0705 2q21-q22 CAGGGGGTTAAAGATCAG 59 292–326 9 1.99 0.47 0.50 (GT)13 AY253993
    GGGGCACATAAAAGGAAG         
TAIGP714P05202Q S0706 18q23-q24 CTGGGTTGCTAAAGAGAC 56 211–215 3 1.05 0.05 0.05 (GT)6 AY253994
    CACCTGAAGGATGTGAG         
TAIGP714O11196Q S0707 13q21 GGTAGGGCTTACTTAACTC 56 163–196 11 6.89 0.85 0.86 i(GT)19i(GC)7(GA)10 AY253995
    GAGAGGGATGAGAATCAG         
TAIGP714I22103Q S0708 3q11-q12 GTTAGTTTCAGGCGTATAG 56 349–397 16 6.57 0.84 0.85 (GT)15i(AT)25(GT)14(AT)11 AY253996
    CTGTGGTATAGGTCGAAG         
TAIGP714F10061Q S0709 16q11-13 TTTAAGACACAGACAGCAG 58 151 1 1 0 0 i(GT)9 AY253997
    CAGCATCTACATCCAGAC         
TAIGP714F10061Q S0710 16q11-13 CTCAGCACCTTACAAACC 58 326–387 14 3.88 0.72 0.74 i(TAAA)7(GT)9 AY253998
    TCCCAAACCAATCCACAC         
TAIGP714F10061Q S0711 16q11-13 CAGAATCTAGCCTCAGCGTC 58 201–209 8 3.06 0.66 0.67 (GT)6(G)10 AY253999
    CACTCCATCCCTCCCAAG         
TAIGP714L02061Q S0712 16q11-13 TGGCATTGCTATGGCTG 57 251–310 14 5.57 0.82 0.82 (GT)12 AY254000
    CACAACCACCTACATATCATC         
TAIGP714L02061Q S0713 16q11-13 CATAATGCCCTCCACATC 54 263–317 22 11.54 0.91 0.91 (GT)17 AY254001
    CCATATCATCCAGCAATTC         
TAIGP714I23038Q S0714 16q11-13 TCTAGCTGTCGTGTAGG 55 199–207 8 3.75 0.70 0.73 (GT)7 AY254002
    GAGGGATTACTCTGAGTTAAG         
TAIGP714I23038Q S0715 16q11-13 GCCCTCCAGGACAAAAC 58 208–242 14 7.16 0.86 0.86 (GT)10i(GC)7i(GT)14 AY254003
    GCTGTGACGTAGGTTGG         
TAIGP714N18001Q S0766 6q27-28 GTGTAGATATGTGTCTGTACA 58 439–471 14 6.98 0.86 0.86 (GAAA)4(CA)6i(CA)16 AY731063
    AGACCTCCTATTAGAGGTGGA         
TAIGP714H02175Q S0767 Xq12-q13 TGACCATGTCTTGTGGTAA 53 239–247 3 2.04 0.40 0.51 (CA)11 AY731064
    CTAGAATGGAAAACAATCTGA         
  1. Ta = Annealing temperature; NE = Effective allele number; PIC = Polymorphism Information Content; HT = Heterozygosity; i = Interrupted sequence.
  2. 1) Physical assignment: S0701 to S0708, and S0767 [24-30]; S0709 to S0715, and S0766 (physical localisation unpublished, but results are available through the website of the INRA-UMN porcine rodent hybrid IMpRH panel [17]