Skip to main content

Advertisement

Table 4 MARC marker information and linkage mapping results

From: Targeted oligonucleotide-mediated microsatellite identification (TOMMI) from large-insert library clones

Marker Forward Primer (5'-3') Reverse Primer (5'-3') Number of Alleles Allele Size Range (bp) Number of Meioses Linkage Position (Chr: cM)
S0701 TGTTTCAGGTACACAGCAGAGTG AACGCGGTTTTGACCTACAG 3 161–167 48 3:31.4
S0705 TGGTTCAGATTGCTGTGGAG ATACCTGCAAACGCTGACCT 5 182–200 62 2:64.3
S0707 GGTAGGGCTTACTTAACTC GAGAGGGATGAGAATCAG 4 165–195 80 13:42.5
S0711 TCTGTTGCTGGCCATGAGT GTTCTGGCAACCCAGTCCT 2 116–119 63 16:5.9
S0712 TTTGCACTCTGCTTTTGAAGA GACCTGCACAACCACCTACA 6 173–221 134 16:0.6
S0713 AGCATAATGCCCTCCACATC GTGGCACCAACAGATGAATG 8 157–185 162 16:0.0
S0715 CCCTCCAGGACAAAACATTC TTTGAGGGAAAGAGGTGGAG 6 191–213 114 16:9.3
S0766 TAGAAACCTGCCCATTGAGG AGGCAGGGACAGGGTCTATT 7 122–144 122 6:102.6