Skip to main content

Table 1 Polymorphisms identified in human DAF. Map positions on human chromosome 1 were from NCBI build 35. Selected tag SNPs are in boldface. Alleles are coded Major > Minor. MAF calculated from the 32 individuals used for tag SNP selection, except for nsSNPs, in which case the MAF is calculated from genotyped controls. DIL = identified by in-house resequencing, HapMap = identified in HapMap II dataset, DIL&HapMap II = Identified in both in-house resequencing and HapMap II dataset.

From: Discovery, linkage disequilibrium and association analyses of polymorphisms of the immune complement inhibitor, decay-accelerating factor gene (DAF/CD55) in type 1 diabetes

Polymorphism – dbSNP(build125) Location MAF AllelicR2 Dataset
  Position(NCBI35) Gene    
ss49853051(G > C) 203881344 promoter 0.03 - DIL
ss49853052(C > T) 203881734 promoter 0.03 - DIL
rs6685886(C > A) 203882613 promoter 0.46 85.07 DIL
rs2564978(C > T) 203882811 promoter 0.33 tag SNP DIL & HapMap
rs3841376 (TAGTTACTTCCCCTCCTTCCC > -) 203882879 promoter 0.33 100.00 DIL
ss49853053(A > G) 203883074 promoter 0.26 tag SNP DIL
ss49853054(T > C) 203883723 intron 1 0.02 - DIL
rs7533852(G > T) 203883822 intron 1 0.44 89.15 DIL
ss49853055(TA > -) 203884424 intron 2 0.03 - DIL
rs4844590(C > T) 203884524 intron 2 0.23 tag SNP DIL
rs2782828(G > T) 203885394 intron 2 0.24 94.47 HapMap
ss49853056(A > G) 203886206 intron 2 0.03 - DIL
ss49853057(C > G) 203887670 intron 4 0.13 tag SNP DIL
ss49853058(G > A) 203888427 intron 4 0.03 - DIL
rs4844591(T > C) 203888688 intron 5 0.33 90.27 DIL & HapMap
rs4844592(A > T) 203889606 intron 5 0.33 90.27 HapMap
rs6703002(G > T) 203890767 intron 5 0.32 88.10 HapMap
rs6700168(C > A) 203890929 intron 5 0.38 82.68 HapMap
rs925130(A > G) 203891827 intron 5 0.33 100.00 HapMap
rs925131(G > A) 203892116 intron 5 0.33 90.27 HapMap
ss49853059(C > T) 203892582 intron 5 0.02 - DIL
rs2184476(A > G) 203893064 intron 6 0.45 tag SNP DIL
rs1507757(A > C) 203893143 intron 6 0.35 tag SNP DIL
rs6662070(G > A) 203894104 intron 6 0.31 100.00 HapMap
rs1507758(C > G) 203895876 intron 6 0.33 90.27 HapMap
rs1507759(G > A) 203896023 intron 6 0.32 100.00 HapMap
rs12075906(A > G) 203896494 intron 6 0.33 100.00 HapMap
rs1354942(A > G) 203896887 intron 6 0.33 90.27 HapMap
rs7555030(G > A) 203897125 intron 6 0.33 100.00 HapMap
rs7544288(G > A) 203897417 intron 6 0.41 97.09 HapMap
rs1507760(T > C) 203897760 intron 6 0.33 100.00 HapMap
rs1507761(C > T) 203898194 intron 6 0.33 100.00 HapMap
ss49853060(C > T) 203898910 intron 7 0.04 - DIL
rs10746462(G > A) 203898943 intron 7 0.33 90.27 DIL
rs10746463(A > G) 203898991 intron 7 0.33 90.27 DIL & HapMap
ss49853061(G > A) 203899255 intron 8 0.02 - DIL
rs2135923(G > A) 203914988 intron 10 0.33 90.27 HapMap
ss49853066(- > TT) 203921271 intron 10 0.39 97.09 DIL
ss49853062(A > G) 203922987 3' 0.02 - DIL
rs11120766(A > G) 203923074 3' 0.45 84.94 DIL
rs1507765(A > C) 203923641 3' 0.45 84.94 DIL & HapMap
rs11307618(A > -) 203923723 3' 0.41 97.09 DIL
ss49853063(A > G) 203923730 3' 0.41 97.09 DIL
ss49853064(C > -) 203923933 3' 0.39 91.71 DIL
rs12066318(T > C) 203924026 3' 0.33 tag SNP DIL
ss49853065(- > ATG) 203924418 3' 0.45 84.94 DIL
rs11120769(G > T) 203925240 3' 0.45 83.28 DIL
rs11117564(C > A) 203925366 3' 0.45 90.45 DIL & HapMap
nsSNPs      
rs28371588(>) 203884176 Exon 2 0.05 -  
DAF-WESa/b(T > G) 203884266 Exon 2 0.0055 -  
rs12135160(>) 203899090 Exon 8 - -