Skip to main content

Table 1 Primer sequences and products amplified from the bovine SLC38A4, NNAT, NAP1L5, H19, and b-actin genes

From: Assessment of genomic imprinting of SLC38A4, NNAT, NAP1L5, and H19 in cattle

Primer Sequence Product size (bp) and type Number of individuals tested
SLC-Fg TTC ATT CAC TTT GGC TCC ATG CAG C 355; DNA 19
SLC-Rg AAT CAT GCT GCT TGC TGT GG   
SLC-F CCG CTG GTA TAA CCA AGG TAA 354; cDNA  
SLC-R AAT CAT GCT GCT TGC TGT GG   
SLC.EXT ACC TAG TTT TTC ATA AAT TAA AGA CCC TCC T 31; primer extension  
NNAT-Fg CTA AGT TGT GGG TCC AAT CAG CT 695; DNA 11
NNAT-Rg TGT AGT TGT CTG GAT CTC TGT GGT G   
NNAT-FLa TTT CCG CGT GCT GCT GCA GGT GTT CCT 453; cDNA  
NNAT-R TCC CCC TAA GCC CCG TTC CT   
NNAT-FSb TTT CCG CGT GCT GCT GCA GGT GTT CAG GT 370; cDNA  
NNAT-R TCC CCC TAA GCC CCG TTC CT   
NNAT.EXT GAC AAT GAC GAC AAC AAG AGA TCC CTT CCC CAC CCC T 37; primer extension  
NAP1L5-F GTG TGC ATG GAC CTT AGA GG 730; DNA, 13
NAP1L5-R TTG TCA TGA TCT CCA GCA CC cDNA  
NAP1L.EXT TTC TCA ATG CCG AAT TCT TCC ATT T 25; primer extension  
H19-JY511 GAC CTA AAG GAA CGG ACG AC 192; DNA 40
H19-JY318 TC CTG AGC AAA GGA TAG CAGA   
H19F GTG CCT CTG AGC TCG GAA CG 580; cDNA  
H19R CTC CTG AGC AAA GGA TAG CAGA   
H19.EXT CCG CGG CGA CAC CCA CCC C 19; primer extension  
b-actin F CAGCACAATGAAGATCAAGATCATC 191; cDNA N/A
b-actin R AAAGGGTGTAACGCAGCTAACAGT