Skip to main content

Table 2 Microsatellite markers used in this study

From: Mapping of a quantitative trait locus for resistance against infectious salmon anaemia in Atlantic salmon (Salmo Salar): comparing survival analysis with analysis on affected/resistant data

Marker name Alternative name Accession number Forward primer Reverse primer
Ssa197DU - U43694 TGAGTAGGGAGGCTTGTG TGACATAACTCTTCTATGGC
Omy301UoG - - ACTTAAGACTGGCAACCTT CTACACGGCCTTCGGGTGAGA
BHMS130 Ssa12NVH AF256663 AGTCAGAGACAACCCTCC TGTCAGTCTGCTAAACACTG
BHMS177 Ssa22NVH AF256673 GCTGTTCATCTGGCTGTG TTCCATTTCCTCCCCCAG
BHMS553 Ssa87NVH AF256732 CTGTAAACATCACAGGCG CTCCACTAATAGTCTGAAGG
BHMS546 Ssa200NVH AF256829 GGGACACTCATCTTGAATG GGTAAGCATTTCACAGTAAG
Ssa401UoS - AJ402718 ACTGGTTGTTGCAGAGTTTGATGC AAACATACCTGATTCCCGAACCAG
BHMS313A Ssa99NVH AF257052 TTCATGTGTGCGAGAGCG AGAATGCAGTATTAGACTGG