Technology to accelerate pangenomic scanning for unknown point mutations in exonic sequences: cycling temperature capillary electrophoresis (CTCE)

Ekstrøm, Per O; Bjørheim, Jens; Thilly, William G

doi:10.1186/1471-2156-8-54

Table 1 Characteristics of 27 fragments used to test separation of CTCE

From: Technology to accelerate pangenomic scanning for unknown point mutations in exonic sequences: cycling temperature capillary electrophoresis (CTCE)

#	Gene symbol	NCBI rs number	DNA variant	PCR primer "Forward" 5'-3'	PCR primer "Reverse" 5'-3'	Mean melting, °C	Δ mean melting, °C	Fragment length, bp
1	BRCA1	rs799923	T59C	*gtccatggtgtcaagtttct	gttggacactgagactggtt	70.7	0.6	147
2	BRCA1	rs16940	T42C	*accccaaagatctcatgtta	cgagatactttcctgagtgc	68.9	0.4	154
3	MTHFR	rs1801133	T28C	*catccctattggcaggtt	aagaaaagctgcgtgatg	75.3	0.3	159
4	OPSIN	ac092402	T51G	*tctgtctttgctgcttcac	tttagaaaatgcctttggtc	70.6	0.1	159
5	MTHFR	rs1801131	A41C	*actccagcatcactcact	gagctgctgaagatgtgg	73.5	0.5	157
6	MTHFR	rs2274976	A35G	*ccaggttgaccaggaagt	gtgtaggacgaggccttt	75.7	0.3	156
7	CBS	rs234706	A45G	*ggtgactgaggtgtcagg	gacgcaccatcacactg	77.6	0.5	168
8	NQO1	rs1800566	T25C	*ctcatcccaaatattctcca	tctgtggcttccaagtctta	72.6	0.2	157
9	DPYD	rs3918290	A53G	*caccaacttatgccaattct	tgcatattggtgtcaaagtg	68.3	0.6	138
10	DPYD	rs17376848	T43C	*caccaacttatgccaattct	tgcatattggtgtcaaagtg	69.0	0.3	138
11	DPYD	rs1801265	T30C	*tcaggatttcttttccaatg	atcctcgaacacaaactcat	70.5	0.7	120
12	CTLA-4	rs5742909	T40C	*tcgaaaagacaacctcaag	aggaaattctccaagtctcc	67.8	0.3	175
13	COL1A1	rs1007086	A64G	*ctaaggatgggaggcacga	ccccctgtaagtatcactcc	76.5	0.2	132
14	COL1A1	rs1061237	T30C	*ttcctgtaaactccctccat	tgaaattgtctcccattttt	73.7	0.2	164
15	COL1A1	rs2857401	T54G	*ctgagatggcagttcttga	ctaaatgtctgttccctcca	74.1	0.2	155
16	COL1A1	rs2249492	T68C	*catagtgccctctctccat	gaggtcttggtggttttgta	76.0	0.4	161
17	COL1A1	rs2277632	A49G	*ctctccctccctcctactc	aatccagtactctcctgtgg	76.6	0.2	166
18	COL1A1	rs2075558	A48G	*catttttcatcaccgactg	agtaatggaggcaggaagat	75.8	0.2	168
19	COL2A1	rs2070739	A46G	*cagtgtacgtgaacctgcta	acctaccactgcaagaacag	76.5	0.3	168
20	COL2A1	rs2276454	T33C	*tccaggtcttcagggaat	tgagaggctgtaacctcagt	76.7	0.6	131
21	COL2A1	rs2276455	T61C	*ggtgagatgaaggaacagg	ctggtgatgaaggtttctgt	71.2	0.3	143
22	COL2A1	rs1635550	T57C	*agaagtacctttgcccaatc	caggaagaccctagacagaa	71.8	0.6	131
23	COL2A1	rs1635537	T94C	*agaaacttgctttgccttct	ctccttccctcctctgtact	72.5	0.3	166
24	COL2A1	rs1793958	T25C	*gatcttgagctcttcattgc	catgaggatatggaggtgac	71.9	0.3	142
25	COL11A1	rs2229783	T87C	*gtctgagtacccattggaaa	caagcagatgcagatgataa	67.3	0.3	157
26	COL11A1	rs3753841	T63C	*attctagggtcctgttggtt	aattggaaacattcactcca	70.2	0.2	151
27	COL11A1	rs2615987	T55G	*tgaatatgcacccttttctt	tgaacaccagaatttgaaca	66.6	0.4	155

For each target chosen, the consensus sequence and a known mutant sequence created by a single base-pair substitution were mixed, melted, and reannealed to create two homoduplexes and two heteroduplexes. For each target sequence, the designating number (#1, 2, 27), gene symbol, NCBI polymorphism reference number, specific mutation with its position in target fragment relative to the 5' end of the reverse primer, PCR primer sequences, average calculated melting temperature of the consensus homoduplex domain (including primer sequences), calculated change in melting temperature of the homoduplex due to the polymorphic base substitution and target fragment length without primers are shown. A thermally stable clamp sequence with a 5' fluorescent label (6-FAM) was synthesized separately for each test fragment incorporating the forward primer for each of the 27 target fragments. Clamp sequence: 6-FAM-CGCCC,GCCGC,GCCCC,GCGCC,CGTCC,CGCCG,CCCCC,GCCCG-forward primer.

Back to article page

ISSN: 2730-6844

Contact us

General enquiries: journalsubmissions@springernature.com

BMC Genomic Data

Contact us