Skip to main content

Table 2 Quantitative RT-PCR conditions and gene-specific primer sequences.

From: Alterations in lipid metabolism gene expression and abnormal lipid accumulation in fibroblast explants from giant axonal neuropathy patients

Gene Quantitative PCR Primers Annealing temp. Reading temp.
Gigaxonin F: catcgtgactgttggtggag
R: tggcaatgctgtccatgtat
62°C 83°C
Complement C3 F: ctggagcagtcaaggtctacg
R: gctcaatggccatgatgtact
66°C 84°C
Butyrylcholinesterase F: aacaccgatcctccaaacttc
R: tcgacattgttgagcacgtag
66°C 80°C
Sialyltransferase F: atacctcactccagcccactt
R: accatgtgctttaccaacagc
66°C 80°C
Fatty acid binding protein 5 (FABP5) F: agttcagcagctggaaggaag
R: tgaaccaatgcaccatctgta
68°C 83°C
ATP-binding cassette A6 (ABCA6) F: actcaccgtgaaggaaaacct
R: aagaccccaccttcttttcaa
66°C 84°C
Meltrin alpha F: agtcaactcagcgagtgcttc
R: ggcacttggtgtggatattgt
66°C 86°C
ATP-binding cassette B4 (ABCB4) F: ctcgatggtcaagaagcaaag
R: ttttgacctcctgagagctga
66°C 84°C
Acyl coenzyme A: cholesterol acyltransferase F: ctgattccagaagccactgag
R: ctcttctgaggcaccctcttt
66°C 85°C
Leptin F: ccaaaaccctcatcaagacaa
R: gctcttagagaaggccagcac
66°C 86°C