Skip to main content

Table 8 Primers and probes used in RT-qPCR assays of gene expression.

From: The influence of gene-environment interactions on GHR and IGF-1 expression and their association with growth in brook charr, Salvelinus fontinalis (Mitchill)

Target gene Primer Set (5'→3') Probe (5'→3')
IGF-1 Forward: CAGGCATCCAGATTGTGCAA CAGCCATTACTCTCTG
  Reverse: ACCATGTTCTGAGAATTCCTGTGTT  
GHR Forward: CCCACTGCCCCCTGTATCT ACCATGGTGGAAGGAG
  Reverse: CTTCAGAAGGAGGCTGTTTTGC