Skip to main content

Table 3 Nucleotide sequences for the forward (F) and reverse (R) primers used in the POU5F1 sequencing reactions

From: Sequence variation in the human transcription factor gene POU5F1

Oligo Name Sequence Oligo Name Sequence
01F GCTGCTCATCTCACCTCTCC 14R AGGTGATTGTTTGAGCAAAGG
01R AAACACCTTCCCCAATTTCC 15F AGATGGAGTCTCACTCTGTC
02F GCTCATATCCAGCCACAAGG 15R TTGAGCCCAAGAGTTAGAAAGC
02R AATACCTGCCACAGGTCTGC 16F GGCCTCCCAAAGTGAAGG
03F ACCAGGCCCCATAATCTACC 16R TGCATACACACAAACACAGC
03R TCATGCTGCTGGTCTAGTGC 17F GATGTCAGGGCTCTTTGTCC
04F GAGCCCCCAGACTTACCC 17R AAAGAAGATAGTTCATTTAATACCTGCAAAA
04R AGAGGGGGCAGCTCTAACC 18F GATCTCAGCTCACTGCAACC
05F CTCCTCTGCGTCTTTCTGC 18R TCGGGATTCAAGAACCTACG
05R CTGCACATCAGGTTCCTTGC 19F TGGGTGAATGACATTTGTGG
06F CTCCCAGGCTTCTTTGAACC 19R CGTTTGGCTGAATACCTTCC
06R AATCCTAGGCATTCCCATCC 20F TCTGGGAAGAGGTGGTAAGC
07F GTGCTTATGGCTGTTGATGC 20R CTGGTTCGCTTTCTCTTTCG
07R GTCTGTGGAAGGGGAAAACC 21F AAAGCTTGCCCTTGTCACC
08F GAGCAGAAGGATTGCTTTGG 21R CCTCTCGTTGTGCATAGTCG
08R GGCCTTGGAAGCTTAGCC 22F GAATGTCCAAGCAGAGTCAGG
09F TGAGTAGTCCCTTCGCAAGC 22R GATGTGGGATTAAAATCAAGAGC
09R ACCCTGCCTGCTCCTCTCC 23F AGGAATTGGGAACACAAAGG
10F AGGAGGCAAGTGAGCTTCG 23R TCTGGTTGGGGTGATCTAGG
10R GGTAAACCCAGCTCACAACG 24F GTTCAGAGCTGGCTTTTTGC
11F GGGTAAAAACAGTGCTCATTCC 24R GAAGATTTATTTACAGGCTTCACC
11R CCCCCTAGGAGATTTTGTGC 25F GCCATCACACTGGTAAACTGC
12F ATAATGGCTGGCAATTGTGG 25R GCACCTATCAGTTGCAAAAGC
12R CTGAGGATGACTGGGTTTGG 26F GGTCGCTACGATTTTGTTGG
13F CACCCTCAAGGCTTAAATGC 26R CCTGGGTTCAGTGTGATGG
13R TGAGAGTTTCGCTTTTGTTGC 27F CGCTGCTGTGTCTACTCATGG
14F AAAAAAGGTGAGGCTAGGTGC 27R AACCGGAGTGAGCATGTCC