Skip to main content

Table 1 The primer forward and reverse sequences, amplicon sizes and gene positions

From: Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity

Gene SNP position Accession number/locus Forward sequence Reverse sequence Amplicon size (bp) Gene position Reference
MYOD1 G302A U12574 CCCGTCAGTCAGGAGGGACAG CTTGGGCAGCCGCTGATTCG 612 promoter Urbański and Kurył 2004 [3]
C489T 1st exon
G566C 1st exon
GDF8 G435A AY527152 GCCCTCTGGTCAAATGAGAA TTTTCCTTTTGCTCGCTGTT 1234 promoter Stinckens et al. 2005 [26]
A447G promoter
A879T promoter