Open Access

Development of Cymbidium ensifoliumgenic-SSR markers and their utility in genetic diversity and population structure analysis in cymbidiums

BMC Genetics201415:124

https://doi.org/10.1186/s12863-014-0124-5

Received: 14 May 2014

Accepted: 30 October 2014

Published: 5 December 2014

Abstract

Background

Cymbidium is a genus of 68 species in the orchid family, with extremely high ornamental value. Marker-assisted selection has proven to be an effective strategy in accelerating plant breeding for many plant species. Analysis of cymbidiums genetic background by molecular markers can be of great value in assisting parental selection and breeding strategy design, however, in plants such as cymbidiums limited genomic resources exist. In order to obtain efficient markers, we deep sequenced the C. ensifolium transcriptome to identify simple sequence repeats derived from gene regions (genic-SSR).

Result

The 7,936 genic-SSR markers were identified. A total of 80 genic-SSRs were selected, and primers were designed according to their flanking sequences. Of the 80 genic-SSR primer sets, 62 were amplified in C. ensifolium successfully, and 55 showed polymorphism when cross-tested among 9 Cymbidium species comprising 59 accessions. Unigenes containing the 62 genic-SSRs were searched against Non-redundant (Nr), Gene Ontology database (GO), eukaryotic orthologous groups (KOGs) and Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The search resulted in 53 matching Nr sequences, of which 39 had GO terms, 18 were assigned to KOGs, and 15 were annotated with KEGG. Genetic diversity and population structure were analyzed based on 55 polymorphic genic-SSR data among 59 accessions. The genetic distance averaged 0.3911, ranging from 0.016 to 0.618. The polymorphic index content (PIC) of 55 polymorphic markers averaged 0.407, ranging from 0.033 to 0.863. A model-based clustering analysis revealed that five genetic groups existed in the collection. Accessions from the same species were typically grouped together; however, C. goeringii accessions did not always form a separate cluster, suggesting that C. goeringii accessions were polyphyletic.

Conclusion

The genic-SSR identified in this study constitute a set of markers that can be applied across multiple Cymbidium species and used for the evaluation of genetic relationships as well as qualitative and quantitative trait mapping studies. Genic-SSR’s coupled with the functional annotations provided by the unigenes will aid in mapping candidate genes of specific function.

Keywords

Cymbidium ensifolium Genic-SSR Genetic diversity Population structure

Background

Cymbidium is a genus of 68 species in the orchid family [1]. Cymbidium species are mainly distributed in the tropical and subtropical regions of Asia, including northwest India, China, Japan, Korea, the Malay Archipelago, and north and east Australia [2],[3]. A total of 49 species can be found in China, including five famous species, i.e., C. goeringii, C. faberi, C. ensifolium, C. kanran, and C. sinense. These cymbidiums comprise some of the rarest plant species, with only a few surviving original populations and some reintroduced plants in the south of China, including Yunnan and Taiwan [4]. The fascinating varieties and shapes of their flowers endow these species with extremely high ornamental value that has attracted the world’s attention.

Knowledge of the genetic diversity and population structure of germplasm collections is an important foundation for plant improvement [5]. Estimation of genetic distance among germplasm is helpful in selecting parental combinations for creating segregating populations so as to maintain genetic diversity in a breeding program. However, genetic diversity may appear spatially structured at different scales, such as population, subpopulation or among neighboring individuals [6]. Population genetic analyses can provide important parameters including standing levels of genetic variation and the partitioning of this variability within/between populations [7]. The genetic diversity or population structure of C. ensifolium and other cymbidiums have been measured by using different molecular tools, including restriction enzyme polymorphism (RFLP) markers [3], random amplified polymorphic DNA (RAPD) markers [3],[4],[8], amplified fragment length polymorphism (AFLP) markers [4], polymorphisms of internal transcribed spacers (ITS) of nuclear ribosomal DNA and plastid, inter-simple sequence repeats (ISSR) markers [4],[9], and SSRs [10],[11]. Compared with RAPD, ISSR and ITS, SSR markers are more reliable, locus-specific, codominant, highly polymorphic, and well distributed throughout the genome [12]. Moreover, SSR’s only require polymerase chain reaction (PCR), which is a big advantage over RFLP and AFLP. These features make SSR’s well suited for marker-assisted selection, genetic diversity analysis, population genetic analysis, genetic mapping, and genetic map comparison in various species [13],[14].

The number of SSR is very limited for C. ensifolium, due to limited sequence resources. Until now, the National Center for Biotechnology Information (NCBI) contained very limited Cymbidium sequence information, i.e., 692 nucleotide sequences and 78 expressed sequence tags (ESTs) (http://www.ncbi.nlm.nih.gov/nucest?term=cymbidium%5BOrganism%5D, verified 2014). RNA-seq provides a fast, cost-effective, and reliable approach for generating large-scale transcriptome data in non-model species, and also offers an opportunity to identify and develop genic-SSRs by transcriptome data mining [15]. Compared with traditional ‘anonymous’ SSRs from genomic DNA, these new genic-SSR markers have two advantages, i.e. a wealth of functional annotations and high transferability across taxa [15],[16]. Herein, we extracted the total mRNA from C. ensifolium flower buds for RNA-seq, which resulted in 9.52 Gb of transcriptome data. From the C.ensifloium transcriptome, we obtained 55 new polymorphic microsatellite loci after testing their transferability across 59 Cymbidium accessions.

Methods

Plant materials

A total of 11 C. ensifolium accessions were employed to test genic-SSRs and additional 47 accessions from C. lancifolium, C. floribundum, C. suavissimum, C. cyperifolium, C. qiubeiense, C. faberi, C. goeringii and C. sinense were used to cross-test these markers among multiple species. The plants were grown and maintained in a greenhouse at the Zhejiang University under natural light (Table 1). Fresh leaf samples were collected from two or three seedling of each accession for genomic DNA extraction.
Table 1

Fifty nine cymbidium accessions used for genetic analysis

Accession

Name

Group a

Species

1

Tiegusu

4

C. ensifolium

2

Qingshanyuquan

4

C. ensifolium

3

Jinsimawei

4

C. ensifolium

4

Jinhe

4

C. ensifolium

5

Yinsimawei

4

C. ensifolium

6

Dayibai

4

C. ensifolium

7

Dahongzhusha

2

C. ensifolium

8

Qiuhong

4

C. ensifolium

9

Baodao

4

C. ensifolium

10

Jinhe

2

C. ensifolium

11

Tianhe

4

C. ensifolium

12

Shisantaibao

4

C. ensifolium

13

TuerA

2

C. lancifolium

14

TuerB

2

C. lancifolium

17

DuohualanA

5

C. floribundum

18

GuoxianglanA

2

C. suavissimum

19

ShayelanA

1

C. cyperifolium

20

ShayelanB

1

C. cyperifolium

21

ShayelanC

1

C. cyperifolium

22

ShayelanD

1

C. cyperifolium

23

QiubeidonghuiA

2

C. qiubeiense

24

ShayelanE

1

C. cyperifolium

25

LvlanA

1

C. faberi

26

GuoxianglanB

5

C. suavissimum

27

lvlanB

1

C. faberi

28

DuohualanB

5

C. floribundum

29

Yuhudie

2

C. goeringii

30

Yinhe

5

C. goeringii

31

Silan

2

C. goeringii

32

Hexingmei

5

C. goeringii

33

Dasongmei

2

C. goeringii

34

Yipin

2

C. goeringii

35

Huangmei

2

C. goeringii

36

Puchunhong

2

C. goeringii

37

Chunjiansuxin

2

C. goeringii

38

Hongmeigui

2

C. goeringii

39

Wenyi

2

C. goeringii

40

Jiuxianmudan

2

C. goeringii

41

Dayipin

3

C. faberi

42

Ruyisu

2

C. faberi

43

Jiepeimei

3

C. faberi

44

Xinshanghaimei

3

C. faberi

45

Laoranzi

3

C. faberi

46

Xiashanjiujielan

3

C. faberi

47

Guifei

3

C. faberi

48

Mingyue

3

C. faberi

49

Xiyang (Qingxiang)

3

C. faberi

50

Yuchan

3

C. faberi

51

QiubeidonghuiB

2

C. qiubeiense

52

DuohualanC

5

C. floribundum

53

DuohualanD

5

C. floribundum

54

QiubeidonghuiC

2

C. qiubeiense

57

Wuzicui

2

C. sinense

58

Jinhuashan

2

C. sinense

59

Rixiang

2

C. sinense

60

Qihei

2

C. sinense

61

Damo

2

C. sinense

62

Hongmeiren

2

C. sinense

63

Baimo

2

C. sinense

aFive groups indicated by population structure analysis.

Genic-SSR search and primer design

Total RNA was isolated from native cultivar of C. ensifolium Tiegusu using TRIzol? reagent (Invitrogen, CA, USA) and treated with RNase-free DNase I (TaKaRa Bio, Dalian, China) for 45 min according to the manufacturer’s protocol. The RNA was used in cDNA library construction and Illumina deep sequencing [17]. The raw sequencing reads were stringently filtered, and high-quality reads were assembled de novo using Trinity with an optimized k-mer length of 25 [18]. MSATCOMMANDER V. 0.8.2 [19] was used to analyze SSR distribution. The minimum number of repeats for SSR detection was as follows: six for di-SSRs, and four for tri-, tetra-, penta-, and hexa-SSRs. The open reading frame (ORF) and untranslated region (UTR) within unigenes were identified using Trinity [18]. Software Primer3.0 [20] was used to design primers for genic-SSR loci with sufficient flanking sequences.

Unigenes containing genic-SSRs were compared with protein databases, including the non-redundant (Nr) database (http://www.ncbi.nlm.nih.gov/), using BLASTX with a significance cut-off E-value of 1e-5 [17]. For the non-redundant annotations, BLAST2GO V. 2.4.4 was used to obtain Gene Ontology (GO) annotations of unique transcripts [21]. Metabolic pathway analysis were performed based on the pathways of Oryza sativa in the Kyoto Encyclopedia of Genes and Genomes (KEGG) [22],[23]. The unigene sequences were also aligned to the KOG (Eukaryotic Orthologous Groups) database to predict and classify possible functions [24].

Genotyping

Genomic DNA was extracted from leaf samples as previously described [25]. PCR primers were synthesized by Life Technologies (AB & Invitrogen, Shanghai, China). PCR reactions were conducted based on a previously published protocol [26]. The PCR products were separated through polyacrylamide gel electrophoresis using 8% bis-acrylamide, 0.5% TBE buffer, 0.07% APS, and 0.035% TEMED. The gel was run at constant 120 V for approximately 3 h in 1? TBE buffer. The gel was silver-stained according to Li s procedure [27], and was then documented using a scanner. The genotype was determined by analysis of the bands pattern, dependent on the number and the position of bands.

Statistical analysis

Genetic distance was calculated using Nei’s distance [28]. Phylogenetic reconstruction was based on the unweighted pair-group method that utilizes the arithmetic average (UPGMA) method implemented in PowerMarker version 2.7 [29]. The tree that was used to visualize the phylogenetic distribution of accessions and ancestry groups was constructed using MEGA version 4 [30]. A model-based program structure [31] was used to infer population structure with 5,000 burn-in and run length. The model allowed for admixture and correlated allele frequencies. The number of groups (K) was set from 1 to 10, each with 10 independent runs. The most probable structure number (K) was determined through log probability [32]. Principal component analysis (PCA), which summarizes the major patterns of variation in a multi-locus data set, was performed using NTSYSpc version 2.11 V [33]. Two principal components were used to represent the dispersion of the collection accessions graphically [34]. PowerMarker was used to calculate the average number of marker alleles and the polymorphism information content (PIC) values. Fixation index (Fst), which indicates the differentiation among genetic groups, was calculated using an Analysis of Molecular Variance (AMOVA) approach in Arlequin V2.000 [35].

Results

Genic-SSR search and primer design

In C. ensifolium transcriptome, 98,819,349 reads, (9.52 Gb), were obtained after removal of adaptor sequences, ambiguous reads, and low-quality reads (Q-value <25). These reads were used for the subsequent assembly, and then resulted in 101,423 unigenes (139,385,689 residues). The length of unigenes averaged 1,374 bp and ranged from 351 bp to 17,260 bp. The data were uploaded to the NCBI (http://orchidbase.itps.ncku.edu.tw/est/home2012.aspx) for public use (Accession: SRA098864).

In the present study, 7,936 genic-SSRs were identified, with one SSR locus for every 17.56 kb (kb/SSR). Estimated locations (coding, 5′UTR or 3′UTR) were obtained for 5,524 genic-SSRs. Sequence information could not be determined for the remaining 2,412 genic-SSR regions, because the locations were extended over both estimated coding and non-coding regions. Given such high numbers of SSR, we analyzed the sequence data to isolate high quality SSR loci for further testing. An important factor considered was the locations of SSRs relative to ORFs. SSRs within UTR are exposed to lower selective pressure than those in coding regions and have a higher likelihood of being polymorphic [36]. Another two factors are the length of the motif and the number of the repeat motif, which are often associated with polymorphism [37]. Thus, SSR’s within UTR, with short motifs and high repeat number would be the best marker candidates. Herein, we selected 80 genic-SSRs and designed primers based on their motifs, sizes and locations.

Genic-SSRs profile

All primer sets were initially tested among 12 C. ensiflolium accessions, and then were cross-tested among other 47 Cymbidium accessions (Table 1). Of the 80 genic-SSR primers, 62 amplified within C. ensifolium accessions successfully, and 55 showed polymorphism when cross-tested among all 9 cymbidium species (Additional file 1: Figure S1). These accessions belonged to 9 cymbidium species i.e. C. ensifolium, C. lancifolium, C. suavissimum, C. cyperifolium, C. qiubeiense, C. floribundum, C. goeringii, C. faberi and C. sinense. Among the 55 polymorphic markers, the PIC averaged 0.407, ranging from 0.033 (for both SSR29 and SSR31) to 0.863 (for SSR73). Similarly, allele number averaged 5.75, ranging from 2 (for SSR06, SSR24, SSR29, SSR31, SSR46, SSR55, SSR71, SSR75 and SSR79) to 16 (for SSR73) (Table 2). These results suggested that genic-SSR markers had a broad applicability within Cymbidium genus.
Table 2

List of the 62 C. ensifolium genic-SSR primers including their unigenes annotation

Name

Product size (bp)

SSR

SSR location

Primer

Homologs in non-redundant database (accession in Genebank)

GO annotation

KOG annotation

KEGG annotation

Allele number

PIC

SSR01

400-500

(AC)8

utr5

F: AACGCCATGTCCAATACCC

PREDICTED: probable transcription factor KAN2-like (XP_002278005.2)

GO: 0003677

KOG1601

NULL

5

0.552

    

R: GGAGGGCTTATTTGCAGCG

      

SSR02

300-400

(AC)8

utr5

F: CTCCTTCAAGCTTCTGCCC

PREDICTED: histone-lysine N-methyltransferase, H3 lysine-9, H3 lysine-27, H4 lysine-20 and cytosine specific SUVH2 (XP_002282386.1)

GO: 0042393

NULL

NULL

NA

NA

    

R: GACCGCAGCGTTAATGACC

      

SSR03

400-500

(AC)8

utr3

F: CTCGGTTCATTTGCAGCCC

PREDICTED: mitochondrial import receptor subunit TOM20 (XP_002269795.1)

GO: 0045040

NULL

NULL

7

0.690

    

R: GGGTGGGTATGGCGAAATC

      

SSR04

400-500

(AC)8

utr3

F: AGAATCTGCCAACCCTTGATAC

NULL

NULL

NULL

NULL

6

0.657

    

R: GCAGATGCCAGTTAGAATGGG

     

SSR05

1000

(AC)8

utr3

F: AGAACTGCAGGTGTGAAGC

PREDICTED: protein CbbY, chromosomal-like isoform 1 (XP_003574671.1)

GO: 0016787

NULL

NULL

3

0.125

    

R: GGCTTGAAGTGGCGATAACC

     

SSR06

600

(AC)9

utr3

F: GCGTCTGCTGAAACGATGG

Putative steroid 22-alpha-hydroxylase (AAN60994.1)

GO: 0016020

KOG0157

K09587

2

0.063

    

R: AAACAGCGCCTGTCATTCC

      

SSR07

300-400

(AC)9

utr3

F: ACGCTGCATCCCATTTCAC

PREDICTED: uncharacterized protein LOC100243361 (XP_002276849.2)

GO: 0008987

NULL

K03517

4

0.180

    

R: CAGTCTGTTGAGGAAGCCG

      

SSR08

100-200

(AC)10

utr3

F: TGCTGGAATACATGCGAGAC

Predicted protein (XP_002298559.1)

GO: 0023014

KOG0610

 

14

0.753

    

R: GTTTGCCGAAGCCAGTGC

      

SSR11

600

(AG)10

utr3

F: AACTGACAAGCATCTGCAAG

Uncharacterized protein LOC100273319 precursor (NP_001141232.1)

GO: 0005774

NULL

NULL

6

0.477

    

R: CTGCTGCATTGGCCTTACC

      

SSR12

300

(AG)11

utr5

F: TCAGCCGAGGTTAGTATACGG

PREDICTED: phosphatidylinositol-4-phosphate 5-kinase 9-like (XP_002265706.1)

GO: 0016020

KOG0229

K00889

NA

NA

    

R: CTTGCCATCTCAGCAGTCG

      

SSR13

400-500

(AG)11

utr5

F: GCTGCTGCTTGGTGGAAAC

Predicted protein (XP_002317724.1)

GO: 0005488

NULL

NULL

6

0.343

    

R: GCGCTCGTTGTATGGCTTG

      

SSR14

300

(AG)11

utr5

F: CACAGCAGCTCACAATCCTG

Unnamed protein product (CBI20568.3)

GO: 0006099

KOG1257

K00029

8

0.467

    

R: TACAGCCCTGTTTACCGCC

      

SSR15

100-200

(AG)11

utr3

F: CCTTCTCTCCGCGTACCAG

PREDICTED: uncharacterized protein LOC100825549 (XP_003558805.1)

GO: 0005783

NULL

NULL

4

0.339

    

R: CTTCGGTTGGCGTTTAGGG

      

SSR16

300-400

(AG)11

utr5

F: GCCCACAGCAATCCATCTG

PE repeat family protein (XP_003014087.1)

NULL

NULL

NULL

7

0.348

    

R: GCAGTCGAAGAAACCGTGG

      

SSR17

400

(AG)11

utr5

F: GGATCACCAACAGCATGGG

Transcription factor (ADG57844.1)

GO: 0003677

NULL

K09060

4

0.417

    

R: TCCACCAAGAGCAAGGATG

      

SSR18

300

(AG)11

utr5

F: TGAAACGGTTGGCTCTAGTTC

Conserved hypothetical protein (XP_002527260.1)

NULL

NULL

NULL

13

0.519

    

R: AGCAAGCACTGACCTGAAAC

     

SSR21

300-500

(GT)8

utr3

F: TGGGCGACAGATCGAGTTC

Hypothetical protein OsJ_08996 (EAZ25197.1)

NULL

NULL

NULL

15

0.794

    

R: ACATGGACCACAGCATTCC

      

SSR22

200-300

(GT)9

utr3

F: TATGCGTCTCTCCCAACCG

14-3-3-like protein B-like(ACQ45020.1)

GO: 0019904

KOG0841

K06630

10

0.572

    

R: AAGCTAGTGGCCTTTGGTG

      

SSR23

100-200

(GT)10

utr3

F: CGGCGATCGATTTATGAGCC

PREDICTED: beta-amylase 1, chloroplastic isoform 1 (XP_002285569.1)

GO: 0005634

NULL

K01177

NA

NA

    

R: CGATACTCCTCAATGTCGTGG

     

SSR24

200-300

(GT)11

utr5

F: TCGGTAACCTGTTGCAAGG

PREDICTED: flavin-containing monooxygenase YUCCA6-like (XP_003550114.1)

GO: 0050661

NULL

K11816

2

0.063

    

R: ACCTGTGAAGCTACCAGAC

      

SSR25

100-250

(GT)11

utr3

F: GAATCTCTCGCACCCGAAG

Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B, putative (XP_002528338.1)

GO: 0006536

NULL

K02434

NA

NA

    

R: TGGACAACATCAAGTGACGC

     

SSR26

100-250

(AAG)7

utr3

F: GCTTTATGCGACATCTGCG

Unnamed protein product (CBI25980.3)

GO: 0005634

KOG1901

NULL

11

0.638

    

R: CGTCGGTTCCATGCACATC

      

SSR27

500-600

(AGC)5

utr3

F: CTGCCTTCACAGCTAATGCC

Os04g0512400 (NP_001053298.1)

GO: 0046872

NULL

NULL

3

0.313

    

R: GCATGCTTGGACGCTGAAC

      

SSR29

200-300

(AGC)6

utr3

F: AGCAAACGGCAAGTCATGG

RING finger protein 113A, putative (XP_002522169.1)

GO: 0016020

NULL

K13127

2

0.033

    

R: ATTCGACTACCAGCCGGAC

      

SSR30

200-300

(AGG)5

utr3

F: AAACGAAGGGCTGGAAGTC

NULL

NULL

NULL

NULL

9

0.486

    

R: TTTGACATCGGGAAGTGGC

      

SSR31

100-200

(AGG)5

utr5

F: GGGATGCATAGACCTTTCGC

Protein MSF1, putative (XP_002535293.1)

GO: 0005739

KOG3336

NULL

2

0.033

    

R: CAGGTTCAACGGCATCGTG

      

SSR32

1000-1100

(AGG)5

utr3

F: CTCCGGCCTCTGGTTACTC

PREDICTED: HVA22-like protein j (XP_002281038.1)

NULL

KOG1726

NULL

7

0.601

    

R: AGTGATGAGGCTTGGACCG

      

SSR34

700-900

(AGG)6

utr5

F: GAGAGGGAATTGCAGTGGC

Hypothetical protein (BAI68347.1)

NULL

NULL

NULL

6

0.696

    

R: ACCGAGCTAGCACTTCATC

      

SSR35

700-900

(ATC)5

utr5

F: AGAGTGATTGTCCAGCTCCG

PREDICTED: diacylglycerol kinase-like (XP_003534537.1)

GO: 0009395

NULL

K07029

4

0.475

    

R: TGCCTCTCTGGTGATGTCC

      

SSR36

400-500

(ATC)5

utr3

F: AGTATTGGACCCTCCAGGC

NULL

NULL

NULL

NULL

5

0.536

    

R: AGAGGATCATGGTGTTAGGC

     

SSR37

200-300

(ATC)5

utr5

F: GGCCTAGCCAGCCCTTC

NULL

NULL

NULL

NULL

3

0.205

    

R: ATTTGGATCGCACAAGCGG

      

SSR38

200-300

(ATC)6

utr3

F: TAGCCCATGCCAGTGTTCC

LOC100285373 (NP_001151738.1)

GO: 0007165

NULL

NULL

3

0.149

    

R: AACTGCCACAAGAGAAGGC

      

SSR39

1000-1100

(ATC)6

utr3

F: ACAGACTGCCACCTGTTCC

unnamed protein product (CBI38283.3)

GO: 0008234

KOG1870

K11835

5

0.401

    

R: GCCTGCCTTTGCTCCTTG

      

SSR40

400

(ATC)6

utr5

F: ACAAGCATCATCCCAAATTCC

PREDICTED: probably inactive leucine-rich repeat receptor-like protein kinase At2g25790-like (XP_002267653.1)

GO: 0007165

NULL

NULL

NA

NA

    

R: GCAGAAACTGGAGCTTGCC

      

SSR42

200-300

(CCG)5

utr5

F: GACGACATATCGCGTTCGG

unnamed protein product (CBI18667.3)

GO: 0003779

KOG0160

NULL

6

0.564

    

R: CTCAGCCACACCCAAGAGG

      

SSR43

500

(CCG)5

utr5

F: GGAGCTGCATACGCAAGTG

glycinebetaine/proline transporter (BAJ07206.1)

GO: 0015193

NULL

NULL

7

0.572

    

R: AGCTTCTCACTGCCTCCAG

      

SSR44

300-400

(CCG)5

utr5

F: CGTCGACTCCTCGAGATCC

predicted protein (BAJ93650.1)

GO: 0046872

NULL

NULL

NA

NA

    

R: GCGTTAGCAGCAGTCTTGG

      

SSR45

400-500

(CCG)5

utr5

F: GCCTTACACATCCCTTCCAAC

unnamed protein product (CBI33381.3)

GO: 0005515

KOG0550

NULL

5

0.338

    

R: TGCCTGCTGATAGTTTGCC

      

SSR46

200-300

(CCG)6

utr5

F: CCTTCGTGGACTCAACAGC

hypothetical protein SORBIDRAFT_01g031510 (XP_002465065.1)

NULL

NULL

NULL

2

0.063

    

R: TCTCGTGCAGGAATCGGTC

      

SSR47

400-500

(CCG)6

utr3

F: GCAGGTGTCCTCATCGGAG

CONSTANS-like protein (ADN97077.1)

GO: 0005622

KOG1601

NULL

NA

NA

    

R: CTCCGGCTAACTCCATCCC

      

SSR49

300

(CCG)7

utr3

F: AGAGGGCCACCTGCTTTC

predicted protein (XP_002312577.1)

NULL

KOG1863

NULL

6

0.549

    

R: GCCAATTGCCAGATGGACG

      

SSR52

400-500

(CCT)4

utr5

F: AAGAGGCACTGCAAGACCC

hypothetical protein SORBIDRAFT_01g031070 (XP_002465040.1)

NULL

NULL

NULL

8

0.378

    

R: CGTTCCAGCAACCCATAGC

      

SSR53

100-200

(CCT)4

utr5

F: GCTGAAGGTTCCGGTCCTC

PREDICTED: uncharacterized protein LOC100830480 (XP_003580351.1)

NULL

NULL

NULL

8

0.700

    

R: TCCGCCTCTTTAAGCCGAC

      

SSR54

200-300

(CCT)4

utr5

F: ATCTTCCCTCCACATCGGC

hypothetical protein MTR_1g083540 (XP_003591171.1)

GO: 0005886

NULL

NULL

5

0.422

    

R: TGGAGAAGAGTCGACCAGC

      

SSR55

200-300

(CCT)4

utr5

F: TGGAATGGTTCTAGGGCTTC

hypothetical protein (CCA65980.1)

NULL

NULL

NULL

2

0.323

    

R: CCACTGGTACCCTCCTTGG

      

SSR56

900-1000

(CCT)5

utr5

F: TGCTTCATTGTTGGAGGCG

predicted protein (XP_002324427.1)

GO: 0008643

KOG0254

NULL

5

0.315

    

R: AGTGGACGGAGAGTCAAGC

      

SSR59

200-300

(CGG)5

utr3

F: GTTTCCAACGGTCAGCTCG

leucine-rich repeat transmembrane protein kinase family protein (NP_177007.1)

GO: 0005524

NULL

NULL

3

0.432

    

R: GTGATGTGGTAGCATCGCC

      

SSR60

200-300

(CGG)5

utr5

F: TACGGTTTCGACCAGCCTC

Unnamed protein product (CBI41056.3)

GO: 0005634

KOG0265

K10143

4

0.203

    

R: CCATGCAGATCGGGCAAAG

      

SSR62

300-400

(CGG)6

utr5

F: GGTGGGTTAGACCAGCTCC

Hypothetical protein OsI_29809 (EAZ07555.1)

GO: 0005634

NULL

NULL

6

0.570

    

R: TCCTCAAGGCAAAGCTCCC

      

SSR63

100-200

(CGG)6

utr5

F: CTTCCTCCACCTGGATCGC

Uncharacterized protein LOC100277474(NP_001144494.1)

GO: 0008270

NULL

NULL

4

0.308

    

R: CTGCCGATCAATCCGAGAC

      

SSR64

400-500

(CGG)6

utr3

F: CGCTCAAAGAGATGGCACG

Os01g0226200 (NP_001042462.1)

NULL

NULL

NULL

11

0.627

    

R: TAGTACGGCGCTGCTTGAG

      

SSR66

300-400

(CGG)7

utr3

F: CATCTTCCTTGCCCGATGC

PREDICTED: pentatricopeptide repeat-containing protein At5g42310, mitochondrial (XP_002272226.1)

NULL

KOG4197

NULL

4

0.126

    

R: CCCGCCAAATTTCGAGACC

      

SSR68

100-200

(GAT)5

utr3

F: CCAGATCGAATGGCTACGC

Hypothetical protein VITISV_010525 (CAN79523.1)

GO: 0003723

NULL

NULL

4

0.211

    

R: CAAGGAGCTCGTCGAAGG

      

SSR69

200-300

(GAT)5

utr5

F: GTTTAGGCTAGCAGTGCGG

NULL

NULL

NULL

NULL

3

0.149

    

R: TGAGAACGTAGTGAAGTTGCC

     

SSR70

200-300

(GAT)7

utr3

F: CCCAACGCAGAACGATAGC

NULL

NULL

NULL

NULL

5

0.529

    

R: CGGTGGCACAAATGGAACG

      

SSR71

400-500

(GGT)5

utr5

F: GCATCGAAACCACTGTCGC

Hypothetical protein SORBIDRAFT_09g018170 (XP_002439663.1)

NULL

NULL

NULL

2

0.262

    

R: CCCTAGCCGGAGTCTCAAC

      

SSR73

100-200

(GGT)5

utr3

F: GGACACAATGGAGACGAAGG

T4.15 (CCH50976.1)

GO: 0044238

NULL

NULL

16

0.863

    

R: TGCATGAAACCACATGGC

      

SSR75

400-500

(GTT)6

utr3

F: GCCTTTGACCATTCCGTGC

Mitogen-activated protein kinase 1 (AEQ28763.1)

GO: 0043622

KOG0660

K04371

2

0.118

    

R: GGCCGCCATGAGTAAGAAC

      

SSR76

500-600

(GTT)6

utr5

F: AGACAGAGAGTCCCTAAAGGC

NULL

NULL

NULL

NULL

7

0.519

    

R: CAGGGATGTTAAGTGGGCTG

     

SSR77

300-400

(GTT)6

utr3

F: TTTGTGGCAGTGGAAAGCG

NULL

NULL

NULL

NULL

5

0.470

    

R: TGATACCAATGGCAAGGCG

      

SSR79

200-300

(GTT)6

utr5

F: AGGATTCATGTAGCCGACCTC

Hypothetical protein OsI_35425 (EEC67831.1)

NULL

NULL

K10728

2

0.207

    

R: TCCCTGAAGGAGGCAAACC

      

SSR80

400-500

(GTT)7

utr3

F: GCACCCAGCTTGTTTGAGG

NULL

NULL

NULL

NULL

8

0.626

    

R: CCCATACATTACAGGCAAGC

     

Note: A total of 62 genic-SSR markers successfully amplified were listed, however 55 polymorphic markers were used in subsequent population analysis or cross species comparison. NULL: no annotation. NA: monomorphic marker.

Genetic diversity and population structure

These genic-SSRs revealed genetic variation among accessions. The genetic distance among accessions ranged from 0.016 to 0.618, with an average of 0.391. The model-based clustering method revealed five groups (Figure 1A and B). Group 2 had the most accessions (26), with the highest mean genetic distance (MGD) of 0.431 among these accessions; Group 4 had 10, with an average distance of 0.236; Group 5 had 7, with MGD of 0.332; Group 1 and Group5 both had 7 accessions, with MGD of 0.155 and 0.332, respectively; Group 3 had 9, with MGD of 0.213. Genetic distance among five groups was from 0.340 (between group 1 and group 5) to 0.176 (between group 2 and group 4, with average of 0.248) (Table 3).
Figure 1

Population structure based on 55 polymorphic genic-SSRs. A: Phylogenetic tree of five main groups, B: The estimated group structure with each individual represented by a horizontal bar, and C: PCA of five main groups. Group 1 in red, Group 2 in green, Group 3 in blue, Group 4 in yellow, Group 5 in purple, and admixed cultivars indicated by a slight blue gradient.

Table 3

Pairwise comparison of Nei’s genetic distance among groups and mean of genetic distance within group based on 55 polymorphic genic-SSRs

Group

No. of accessions

Mean genetic distance (MGD)

Group 1

Group 2

Group 3

Group 4

Group 5

Group 1

7

0.155

0.000

    

Group 2

26

0.430

0.217

0.000

   

Group 3

9

0.213

0.252

0.190

0.000

  

Group 4

10

0.236

0.212

0.176

0.234

0.000

 

Group 5

7

0.332

0.340

0.263

0.298

0.293

0.0000

The five groups revealed by the model-based clustering analysis consisted of different species. Three groups comprised more than one species, whereas the other two only comprised one species. Group 1 included two species i.e. C. cyperifolium and C. goeringii; Group 2 included C.ensifolium, C. lancifolium, C. suavissimum, C. qiubeiense, C. goeringii, C. faberi, and C. sinense; Group 5 included C. floribundum, C. suavissimum and C. goeringii. Goup 3 and Group 4 included only C. faberi and C.ensifolium, respectively (Figure 2).
Figure 2

Phylogenetic tree of cymbidiums. A: Unweighted pair-group method tree of 59 accessions based on 55 polymorphic SSRs, and B: Morphology of cymbidium’s flower. Group 1 indicated by red dot, Group 2 by green dot, Group 3 by blue dot, Group 4 by yellow dot, Group 5 by purple dot.

The first two components in PCA (47.87% and 21.59% of total variation, respectively) discriminated the five groups at a certain level. Basically, accessions in group 1 and group 3 stayed alone, whereas group 2 overlapped with group 4 and group 5 (Figure 1C). In the phylogenetic tree, group 2 and group 4 were genetically close, while group 5 was relatively distant from the other groups (Figure 1A). In addition, a few accessions in group 2 had admixture ancestry from group 3 and group 4, while accessions in group 3 and group 1 had less admixture ancestry (Figure 1B). AMOVA results showed that 25.34% of the total variation was among groups, while 74.66% of the variation was within groups. The F ST was 0.25, as indicated by the AMOVA approach.

Genic-SSR annotation

Annotations of these unigenes provide biological information for 62 genic-SSRs, such as KOG clusters, GO, and KEGG pathway information. Distinct gene sequences were first searched using BLASTX against the Nr database. The results showed that 53 unigenes had hits that exceeded the E-value threshold. In the present study, 39 unigenes were categorized into 25 GO terms in three GO ontologies (Figure 3A). Two groups membrane and nucleus, one group binding, and one group cellular process comprised the most representative genes found in cellular components, molecular function, and biological processes, respectively. Out of 53 hits in the Nr databases, 18 sequences were classified into 9 KOG categories (Figure 3B). Among the 9 KOG categories, General function prediction only and Posttranslational modification, protein turnover, chaperones were the two largest groups. When referenced to rice (Oryza sativa), 15 unigenes were found to be involved in 14 pathways (Figure 3C). The most highly representative one was metabolic pathways, where unigenes shared similarity with 18 rice sequences.
Figure 3

Functional annotations of unigenes containing SSR. A: KOG prediction and possible function, B: GO functional classifications, and C: KEGG pathways involved.

Discussion

Diversity

Because genic-SSR markers are derived from transcribed regions of DNA, they are expected to be more conserved and have a higher rate of transferability than anonymous SSR markers [38]. Herein, 55 C. ensifolium polymorphic genic-SSR markers exhibited 100% transferability across the 59 accessions of the 9 Cymbidium species tested. It is common that genic-SSRs possess a high potential for inter-specific transferability [39],[40]. Other markers such as RAPD’s, ISSR’s and non-genic SSR’s have also been used with success among C. ensifolium and the Cymbidium species reflecting the genetic similarity among many members of the genus [8],[11],[15].

The conserved nature of the genic-SSRs may limit their polymorphism relative to randomly selected SSR’s. In this study, PIC of genic-SSR markers averaged 0.407, lower than 0.782 [5] and 0.639 [11] of anonymous SSR’s tested on Chinese cymbidiums in other studies. The pair-wise genetic distance averaged 0.391 among 59 accessions, which is also lower than that from previous studies conducted on Chinese Cymbidiums using other molecular markers [3],[8],[41]-[44]. Even though genic-SSRs revealed less variability than SSRs, these markers still reveal sufficient levels of variation for population genetic analysis.

Population structure

One of the biggest advantages for genic-SSRs is that they allow one to make direct comparisons among taxa without running the risk that locus-specific differences might mask true species-level differences, such as overall levels of genetic diversity, the extent of population structure, and so on. However, the greatest concern with the utilization of genic-SSRs in genetic studies is that selection on these loci might influence the estimation of population genetic parameters. While a recent study by Woodhead et al. [45] revealed that estimates of population differentiation based on genic-SSRs are comparable to those based on both SSRs and AFLPs in ferns, and large-scale comparative analysis suggest that only a very small percentage of all genes has experienced positive selection [46],[47], a small fraction of SSRs will be inevitably subject to selection. The view is consistent with the theory that most mutations are neutral, or nearly neutral, [48] or, at least, do not change the function of gene products appreciably [49].

In the population genetic analysis, almost all accessions from the same species clustered together. C. suavissimum and C. floribundum were clustered into one brand, and clearly distinguished from other cymbidiums. Two of them belong to Section Floribundum, and have a distant relationship with other cymbidiums. However, the genetic relationship between C. goeringii and C. sinensis was close, which was congruent with the previous reports [5],[11]. The close relationship was also found between C. ensifolium and C. cyperifolium. In the intersection level, we discovered that two accessions of C. faberi were clustered with C. cyperifoliumm, and accessions of C. lancifolium and C. ensifolium were scattered among ones of C. goeringii. The splitting feature of these clusters might be linked to the non-homologous synapomorphy, even though accessions belonged to different species. The accessions of C. goeringii did not always form a separate cluster in the phylogenetic tree or were not grouped together in structure analysis, suggesting that they were polyphyletic. Previous morphologic, cytogenetic, and molecular studies have shown that the major lineages of Chinese cymbidiums are ambiguous. C. ensifolium and C. sinense are classified in section Jensoa; C. faberi and C. goeringii, are classified in section Maxillarianthe; C. faberi, C. kanran, and C. longibracteatum are classified in one group; C. ensifolium, C. goeringii, and C. sinense are categorized into another group [44].

Genic-SSR annotation

Putative functions were assigned to those unigenes containing SSRs by sequence similarities. These unigenes were involved in a wide range of functions, which indicated that these genic-SSRs were likely important biologically characters. For example, unigene containing SSR47 shares homology with CONSTANS-like protein. In Arabidopsis, the CO (CONSTANS) gene has an important role in the regulation of flowering by photoperiod [50]. Unigene containing SSR43 has homology with a glycinebetaine/proline transporter. The accumulation of glycinebetaine (GB) is one of the adaptive strategies to adverse salt stress conditions [51]. The transporters mediate the uptake of GB and/or proline in many plant species e.g. Arabidopsis thaliana [52], tomato (Solanum lycopersicum) [53], rice (Orazy sativa) [54], barley [55]. Unigene having SSR75, was annotated as mitogen-activated protein kinase (MAPK). MAPK cascades function as key signal transducers that use protein phosphorylation/dephosphorylation cycles to channel information [56]. In the plant, MAPKs have been shown to regulate numerous cellular processes, including biotic stress relief [57],[58]. Although some unigenes with SSRs had no match to known genes in current gene database, they will likely gain functional annotations as the knowledge of plant genes increases. Compared with anonymous SSRs, genic-SSR markers have a higher probability of being functionally associated with differences in gene expression, which may be in identifying associations between genotype and phenotype. Mapping of genic-SSRs will also provide a map location, in many cases, for genes with known functions.

Conclusion

In this work, 7,936 genic-SSRs were identified in C. ensifolium transcriptome and their characterizations were further analyzed. A total of 80 genic-SSRs were chosen for validation, and 55 markers successfully yielded polymorphism across 9 Cymbidium species including 59 accessions. The high transferability of genic-SSR will be a powerful resource for molecular taxonomic studies and construction of a reference molecular map of the Cymbidium genome. Since genic-SSR markers belong to gene-rich regions of the genome, some of these can be exploited for use in marker-assisted breeding of Cymbidium. Therefore, the set of genic-SSR markers developed here is a promising genomic resource.

Additional file

Declarations

Acknowledgments

The authors thank Lin Biao for critical review, the lab of Professor Dianxing Wu for materials supply and technical support, and Chongbo Sun for a part of materials supply. This research was supported by the National Basic Research Program funded by the Nature Science Foundation of China (No. 31201648), the Postdoctoral Science Foundation of China (No. 2012 M521203), the Special Postdoctoral Science Foundation of China (No. 2013 T60607), and the Foundation for Selected Postdoctoral project of Zhejiang (Bsh1201032), the Qianjiang talents project (No. 2013R10081), and Scientific and technical innovation promotion project of ZAAS (2012R05Y01E04).

Authors’ Affiliations

(1)
Zhejiang Academy of Agricultural Sciences
(2)
College of Life Sciences, Hubei University
(3)
Dale Bumpers National Rice Research Center, USDA-ARS
(4)
Agricultural Technology Extension Stations, Shaoxing County Agricultural Bureau
(5)
School of Biological Sciences, The University of Hong Kong
(6)
State Key Lab of Rice Biology, International Atomic Energy Agency Collaborating Center, Zhejiang University

References

  1. Liu ZJ, Chen SC, Ru ZZ, Chen LJ: Chinese Cymbidium plants. 2006, Science, BeijingGoogle Scholar
  2. DuPuy D, Cribb PJ: The genus Cymbidium. 1988, Christopher Helm, LondonGoogle Scholar
  3. Obara-Okeyo P, Kako S: Genetic diversity and identification of Cymbidium cultivars as measured by random amplified polymorphic DNA (RAPD) markers. Euphytica. 1998, 99: 95-101. 10.1023/A:1018374226074.View ArticleGoogle Scholar
  4. Wang L-m, Wang S-q, Yang Y-f: Germ Plasm Resources and Breeding of Orchids. J Anyang Institute Technol. 2005, 2: 1-14.Google Scholar
  5. Li X, Xiang L, Wang Y, Luo J, Wu C, Sun C, Xie M: Genetic diversity, population structure, pollen morphology and cross-compatibility among Chinese Cymbidiums. Plant Breed. 2014, 133: 145-152. 10.1111/pbr.12125.View ArticleGoogle Scholar
  6. Escudero A, Iriondo JM, Torres ME: Spatial analysis of genetic diversity as a tool for plant conservation. Biol Conserv. 2003, 113: 351-365. 10.1016/S0006-3207(03)00122-8.View ArticleGoogle Scholar
  7. Ellis JR, Burke JM: EST-SSRs as a resource for population genetic analyses. Heredity. 2007, 99: 125-132. 10.1038/sj.hdy.6801001.PubMedView ArticleGoogle Scholar
  8. Choi H, Kim MJ, Lee JS, Ryu KH: Genetic diversity and phylogenetic relationships among and within species of oriental cymbidiums based on RAPD analysis. Sci Hortic. 2006, 108: 79-85. 10.1016/j.scienta.2006.01.010.View ArticleGoogle Scholar
  9. Lu J, Hu X, Liu J, Wang H: Genetic diversity and population structure of 151 Cymbidium sinense cultivars. J Horticulture Forestry. 2011, 3: 104-114.Google Scholar
  10. Capesius I: Isolation and characterization of native AT-rich satellite DNA from nuclei of the orchid Cymbidium . FEBS Lett. 1976, 68: 255-258. 10.1016/0014-5793(76)80448-6.PubMedView ArticleGoogle Scholar
  11. Moe KT, Zhao W, Song HS, Kim YH, Chung JW, Cho YI, Park P, Park HS, Chae SC, Park YJ: Development of SSR markers to study diversity in the genus Cymbidium . Biochem Syst Ecol. 2010, 38: 585-594. 10.1016/j.bse.2010.07.004.View ArticleGoogle Scholar
  12. Venkateswarlu M, Raje Urs S, Surendra Nath B, Shashidhar HE, Maheswaran M, Veeraiah TM, Sabitha MG: A first genetic linkage map of mulberry (Morus spp.) using RAPD, ISSR, and SSR markers and pseudotestcross mapping strategy. Tree Genet Genomes. 2006, 3: 15-24. 10.1007/s11295-006-0048-y.View ArticleGoogle Scholar
  13. Kenis K, Keulemans J: Genetic linkage maps of two apple cultivars (Malus x domestica Borkh.) based on AFLP and mocrosatellite markers. Mol Breed. 2005, 15: 205-219. 10.1007/s11032-004-5592-2.View ArticleGoogle Scholar
  14. Rl R, Angiolillo A, Guerrero C, Pellegrini M, Rallo L, Besnard G, Bervill A, Martin A, Baldoni L: A first linkage map of olive (Oleaeuropaea L.) cultivars using RAPD, AFLP, RFLP and SSR markers. Theor Appl Genet. 2003, 106: 1273-1282.Google Scholar
  15. Li X, Xiang L, Luo J, Hu B, Tian S, Xie M, Sun C: The strategy of RNA-seq, application and development of molecular marker derived from RNA-Seq. Chinese J Cell Biol. 2013, 5: 35-Google Scholar
  16. Li X, Cui H, Zhang M: Molecular markers derived from EST: Their development and applications in comparative genomics. Biodiversity Sci. 2006, 14: 541-547. 10.1360/biodiv.060148.View ArticleGoogle Scholar
  17. Li X, Luo J, Yan T, Xiang L, Jin F, Qin D, Sun C, Xie M: Deep sequencing-based analysis of the Cymbidium ensifolium floral transcriptome. PLoS One. 2013, 8 (12): e85480-10.1371/journal.pone.0085480.PubMedPubMed CentralView ArticleGoogle Scholar
  18. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, Adiconis X, Fan L, Raychowdhury R, Zeng Q, Chen Z, Mauceli E, Hacohen N, Gnirke A, Rhind N, di Palma F, Birren BW, Nusbaum C, Lindblad-Toh K, Friedman N, Regev A: Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol. 2011, 29: 644-652. 10.1038/nbt.1883.PubMedPubMed CentralView ArticleGoogle Scholar
  19. Faircloth BC: Msatcommander: detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol Ecol Resour. 2008, 8: 92-94. 10.1111/j.1471-8286.2007.01884.x.PubMedView ArticleGoogle Scholar
  20. Rozen S, Skaletsky H: From methods in molecular Biology: Primer3 on the www for general users and for biologist programmers . Bioinformatics Methods and Protocols volume 132. Edited by: Misener S, Krawetz SA. 2000, Humana Press, New Jersey, 365-385.Google Scholar
  21. Conesa A, Gotz S, Garcia-Gomez JM, Terol J, Talon M, Robles M: Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics. 2005, 21: 3674-3676. 10.1093/bioinformatics/bti610.PubMedView ArticleGoogle Scholar
  22. Kanehisa M, Goto S, Sato Y, Furumichi M, Tanabe M: KEGG for integration and interpretation of large-scale molecular datasets. Nucleic Acids Res. 2012, 40: 109-114. 10.1093/nar/gkr988.View ArticleGoogle Scholar
  23. Kanehisa M, Goto S: KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 2000, 28: 27-30. 10.1093/nar/28.1.27.PubMedPubMed CentralView ArticleGoogle Scholar
  24. Koonin EV, Fedorova ND, Jackson JD, Jacobs AR, Krylov DM, Makarova KS, Mazumder R, Mekhedov SL, Nikolskaya AN, Rao BS, Rogozin IB, Smirnov S, Sorokin AV, Sverdlov AV, Vasudevan S, Wolf YI, Yin JJ, Natale DA: A comprehensive evolutionary classification of proteins encoded in complete eukaryotic genomes. Genome Biol. 2004, 5: R7-10.1186/gb-2004-5-2-r7.PubMedPubMed CentralView ArticleGoogle Scholar
  25. Li XB, Zhang ML, Cui HR: Data mining for SSRs in ESTs and development of EST- SSR marker in oilseed rape. J Mol Cell Biol. 2007, 40: 137-144.Google Scholar
  26. Li X, Cui H, Zhang M: Detecting the genetic diversity of Brassica napus by EST-SSRs. J Agric Biotechnol. 2007, 15: 661-667.Google Scholar
  27. Li ZL, Jakkula RS, Hussey JP, Boerma HR: SSR mapping and confirmation of the QTL from PI96354 conditioning soybean resistance to southern root-knot nematode. Theor Appl Genet. 2001, 103: 1167-1173. 10.1007/s001220100672.View ArticleGoogle Scholar
  28. Nei M, Takezaki N: Estimation of genetic distances and phylogenetic trees from DNA anlysis. Proc 5th World Cong Genet Appl Livstock Prod. 1983, 405-412.Google Scholar
  29. Liu K, Muse SV: PowerMarker: an integrated analysis environment for genetic marker analysis. Bioinformatics. 2005, 21: 2128-2129. 10.1093/bioinformatics/bti282.PubMedView ArticleGoogle Scholar
  30. Tamura K, Dudley J, Nei M, Kumar S: MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 2007, 24: 1596-1599. 10.1093/molbev/msm092.PubMedView ArticleGoogle Scholar
  31. Pritchard JK, Stephens M, Donnelly P: Inference of population structure using multilocus genotype data. Genetics. 2000, 155: 945-959.PubMedPubMed CentralGoogle Scholar
  32. Li X, Yan W, Agrama H, Hu B, Jia L, Jia M, Jackson A, Moldenhauer K, Mcclung A, Wu D: Genotypic and phenotypic characterization of genetic differentiation and diversity in the USDA rice mini-core collection. Genetica. 2010, 138: 1221-1230. 10.1007/s10709-010-9521-5.PubMedView ArticleGoogle Scholar
  33. Rohlf FJ: NTSYS-pc: numerical taxonomy and multivariate analysis system, version 2.1. 2000Google Scholar
  34. Li X, Yan W, Agrama H, Jia L, Shen X, Jackson A, Moldenhauer K, Yeater K, Mcclung A, Wu D: Mapping QTLs for improving grain yield using the USDA rice mini-core collection. Planta. 2011, 234: 347-361. 10.1007/s00425-011-1405-0.PubMedView ArticleGoogle Scholar
  35. Schneider S, Excoffier L: Estimation of past demographic parameters from the distribution of pairwise differences when the mutation rates vary among sites: application to human mitochondrial DNA. Genetics. 1999, 152: 1079-1089.PubMedPubMed CentralGoogle Scholar
  36. Gur-Arie R, Cohen CJ, Eitan Y, Shelef L, Hallerman EM, Kashi Y: Simple sequence repeats in Escherichia coli: abundance distribution, composition, and polymorphism. Genome Res. 2000, 10: 62-71.PubMedPubMed CentralGoogle Scholar
  37. Zalapa JE, Cuevas H, Zhu H, Steffan S, Senalik D, Zeldin E, McCown B, Harbut R, Simon P: Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. Am J Bot. 2012, 99 (2): 193-208. 10.3732/ajb.1100394.PubMedView ArticleGoogle Scholar
  38. Scott KD, Eggler P, Seaton G, Rossetto M, Ablett EM, Lee LS, Henry RJ: Analysis of SSRs derived from grape ESTs. TAG Theor Appl Genet. 2000, 100 (5): 723-726. 10.1007/s001220051344.View ArticleGoogle Scholar
  39. Thiel T, Michalek W, Varshney RK, Graner A: Exploiting EST databases for the development of cDNA derived microsatellite markers in barley (Hordeum vulgare L.). Theor Appl Genet. 2003, 106: 411-422.PubMedGoogle Scholar
  40. Gupta PK, Rustgi S, Sharma S, Singh R, Kumar N, Balyan HS: Transferable EST-SSR markers for the study of polymorphism and genetic diversity in bread wheat. Mol Genet Genomics. 2003, 270 (4): 315-323. 10.1007/s00438-003-0921-4.PubMedView ArticleGoogle Scholar
  41. Huang Y, Li F, Chen K: Analysis of diversity and relationships among Chinese orchid cultivars using EST-SSR markers. Biochem Syst Ecol. 2010, 38: 93-102. 10.1016/j.bse.2009.12.018.View ArticleGoogle Scholar
  42. Wang HZ, Wu ZX, Lu JJ, Shi NN, Zhao Y, Zhang ZT, Liu JJ: Molecular diversity and relationships among Cymbidium goeringii cultivars based on inter-simple sequence repeat (ISSR) markers. Genetica. 2009, 136: 391-399. 10.1007/s10709-008-9340-0.PubMedView ArticleGoogle Scholar
  43. Wang HZ, Wang YD, Zhou XY, Ying QC, Zheng KL: Analysis of genetic diversity of 14 species of Cymbidium based on RAPDs and AFLPs. Acta Biologiae Exp Sinica. 2004, 37: 482-486.Google Scholar
  44. Zhang JX, Li ZL, Fan CM, Cheng SL, Zhao MF, He YQ: Phylogenetics analysis of the Chinese orchids in Yunnan province using AFLP technique. Acta Horticulturae Sinica. 2006, 33: 1141-1144.Google Scholar
  45. Woodhead M, Russell J, Squirrell J: Comparative analysis of population genetic structure in Athyrium distentifolium (Pteridophyta) using AFLPs and SSRs from anonymous and transcribed gene regions. Mol Ecol. 2005, 14: 1681-1695. 10.1111/j.1365-294X.2005.02543.x.PubMedView ArticleGoogle Scholar
  46. Clark AG, Glanowski S, Nielsen R, Thomas PD, Kejariwal A, Todd MA, Tanenbaum DM, Civello D, Lu F, Murphy B, Ferriera S, Wang G, Zheng X, White TJ, Sninsky JJ, Adams MD, Cargill M: Inferring non-neutral evolution from human-chimp-mouse orthologous gene trios. Science. 2003, 302: 1960-1963. 10.1126/science.1088821.PubMedView ArticleGoogle Scholar
  47. Tiffin P, Hahn MW: Coding sequence divergence between two closely related plant species: Arabidopsis thaliana and Brassica rapa ssp pekinensis. J Mol Evol. 2002, 54: 746-753. 10.1007/s00239-001-0074-1.PubMedView ArticleGoogle Scholar
  48. Kimura M: The neutral theory of molecular evolution: a review of recent evidence. Jpn J Genet. 1991, 66 (4): 367-386. 10.1266/jjg.66.367.PubMedView ArticleGoogle Scholar
  49. Nei M: Selectionism and neutralism in molecular evolution. Mol Biol Evol. 2005, 22 (12): 2318-2342. 10.1093/molbev/msi242.PubMedPubMed CentralView ArticleGoogle Scholar
  50. Griffiths S, Dunford RP, Coupland G, Laurie DA: The evolution of CONSTANS-like gene families in barley, rice, and Arabidopsis. Plant Physiol. 2003, 131 (4): 1855-1867. 10.1104/pp.102.016188.PubMedPubMed CentralView ArticleGoogle Scholar
  51. Fujiwara T, Mitsuya S, Miyake H, Hattori T, Takabe T: Characterization of a novel glycinebetaine/proline transporter gene expressed in the mestome sheath and lateral root cap cells in barley. Planta. 2010, 232 (1): 133-143. 10.1007/s00425-010-1155-4.PubMedView ArticleGoogle Scholar
  52. Grallath S, Weimar T, Meyer A, Gumy C, Suter-Grotemeyer M, Neuhaus JM, Rentsch D: The AtProT family. Compatible solute transporters with similar substrate specificity but differential expression patterns. Plant Physiol. 2005, 137: 117-126. 10.1104/pp.104.055079.PubMedPubMed CentralView ArticleGoogle Scholar
  53. Schwacke R, Grallath S, Breitkreuz KE, Stransky E, Stransky H, Frommer WB, Rentsch D: LeProT1, a transporter for proline, glycine betaine, and gamma-amino butyric acid in tomato pollen. Plant Cell. 1999, 11: 377-392.PubMedPubMed CentralGoogle Scholar
  54. Igarashi Y, Yoshiba Y, Takeshita T, Nomura S, Otomo J, Yamaguchi-Shinozaki K, Shinozaki K: Molecular cloning and characterization of a cDNA encoding proline transporter in rice. Plant Cell Physiol. 2000, 41 (6): 750-756. 10.1093/pcp/41.6.750.PubMedView ArticleGoogle Scholar
  55. Ueda A, Shi W, Sanmiya K, Shono M, Takabe T: Functional analysis of salt-inducible proline transporter of barley roots. Plant Cell Physiol. 2001, 42 (11): 1282-1289. 10.1093/pcp/pce166.PubMedView ArticleGoogle Scholar
  56. Hamel LP, Nicole MC, Duplessis S, Ellis BE: Mitogen-activated protein kinase signaling in plant-interacting fungi: distinct messages from conserved messengers. Plant Cell. 2012, 24 (4): 1327-1351. 10.1105/tpc.112.096156.PubMedPubMed CentralView ArticleGoogle Scholar
  57. Pitzschke A, Schikora A, Hirt H: MAPK cascade signalling networks in plant defence. Curr Opin Plant Biol. 2009, 12 (4): 421-426. 10.1016/j.pbi.2009.06.008.PubMedView ArticleGoogle Scholar
  58. Andreasson E, Ellis B: Convergence and specificity in the Arabidopsis MAPK nexus. Trends Plant Sci. 2010, 15 (2): 106-113. 10.1016/j.tplants.2009.12.001.PubMedView ArticleGoogle Scholar

Copyright

© Li et al.; licensee BioMed Central. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.