Skip to main content

Table 1 Primers used for amplification, sequencing and site-directed mutagenesis (SDM) of XYLT1 promoter fragments

From: First description of the complete human xylosyltransferase-I promoter region

Application   Primer sequence ( 5′ → 3 ′) T A[°C]
PCR and sequencing Fragment A CCCTGTTTCGCGGCCCCTG Slowdown-PCR
CCGGAGTCGAGGCTGCTGAA
  Fragment B1 ATGGATGGGGAAAAGGACAC 58.8
TGGGGGAGGAGCCGAGGGAG
  Fragment B2 CAGTCAGGATGGGAAAGAAC 58.8
GGTGCCAACGATGTACTAAG
  Fragment C AACAATCTCTTCCCACTCCC 61.2
GGAGTTACTCAACCTTCGCA
  Fragment D CATGCCCGGCTAATTTTTGT 61.2
CTTCGCATCTTGTCTGCTGT
  Fragment XYLT1 238* ACAGGGGTGTGGGGAGGGGGCGCCGCGCGGGCCAGGCGCC 58.8
GCTCGGGCCGCCGCCGCCGCCGCCGCCTCGGCTCGCCGCT
Plasmid sequencing   CTAGCAAAATAGGCTGTCCC  
   CTTAATGTTTTTGGCATCTTCCA  
SDM c.-403C>T TCCCCCCGGCGCCTTCCCCATTACCCTCCCCTCCAGCGGGGA  
   TCCCCGCTGGAGGGGAGGGTAATGGGGAAGGCGCCGGGGGGA  
  c.-1088C>A GCTGGGAGGCTGCGGGGCCAGACTTTGGGGCTTGCATCCTGC  
   GCAGGATGCAAGCCCCAAAGTCTGGCCCCGCAGCCTCCCAGC  
  1. Mutated bases are marked in bold.