Skip to main content

Table 2 The shortest length for a candidate barcode to reach the maximum discrimination success using genetic distance method

From: A chloroplast genomic strategy for designing taxon specific DNA mini-barcodes: a case study on ginsengs

Markers Maximum discrimination success (%) Shortest length (bp) Primer name Primer sequence 5' to 3'
rbcL 91.67 480 m-rbcLF ACAAATTGACTTATTATACTCCTGA
    m-rbcLR TCGTCTTTGGTAAAATCAAGTCCA
matK 62.5 90 m-matKF CTTCTTGAACGAATCTATTTCTA
    m-matKR CCATAAATTAACAAAGTAATATGT
trnH-psbA 62.5 50 m-HAF TAATCTAGAATTTAGCTACTTCTTC
    m-HAR CCTTGATCCACTTGGCTACATCC
rps16 83.33 280 m-rps16F ATAGGAATGAAGGTGCTCTTG
    m-rps16R ATCCTTCCAACAAAATGGCAGCA
ycf1a 91.67 60 m-ycf1aF TTATTACCGAGTTGGAACAACA
    m-ycf1aR TTGAGTACGCATAGAACCTTTGAT
ycf1b 100 110 m-ycf1bF AAKCAAGAGACAACTTACCTTGA
    m-ycf1bR GGATCAGATGCACAAAACCAAGGAA