Skip to main content


Table 2 The shortest length for a candidate barcode to reach the maximum discrimination success using genetic distance method

From: A chloroplast genomic strategy for designing taxon specific DNA mini-barcodes: a case study on ginsengs

Markers Maximum discrimination success (%) Shortest length (bp) Primer name Primer sequence 5' to 3'
rps16 83.33 280 m-rps16F ATAGGAATGAAGGTGCTCTTG
ycf1a 91.67 60 m-ycf1aF TTATTACCGAGTTGGAACAACA