Skip to main content

Advertisement

Table 2 Primers for CAPs analysis

From: Normal adult survival but reduced Bemisia tabaci oviposition rate on tomato lines carrying an introgression from S. habrochaites

Marker name Chr. Primer sequence Restriction enzyme
TG59 1 AACTCTACGCTGCACTGCTG Hpa II
CTGAAGCTCCACCTTGAGGTG
TG17 1 GGTCTTCCCTTCGTCATTCAT HpyCH4 IV
GTTATTCGGTTCTTGTTCTTCACG
CD2 12 CAGCTGCAACTCCACTACCA Mwo I
GGGCTTGAAGAACTGCACTC
TG68 12 TTTGATTACACCTGCCTTTACATA Dde I
CATGTCAAGGGGATTGAACA