Skip to main content

Advertisement

Table 1 Primers used for Q-PCR validation

From: Identification of skin-expressed genes possibly associated with wool growth regulation of Aohan fine wool sheep

Gene Primer sequence (5’-3’) Tm (°C) a Target size (bp)
GAPDHb Forward: ATGCCTCCTGCACCACCA 60 76
Reverse: AGTCCCTCCACGATGCCAA
FGF10 Forward: GATCCGAGAAAGGAGCGAGG 60 554
Reverse: TCCAGGATACTGTACGGGCA
LOC443300 Forward: ACCAACACATCCCATTCGCT 60 140
Reverse: CACTCAGCGTGTCCAGTTCT
FGF18 Forward: AAGTCCGGATCAAGGGCAAG 60 98
Reverse: CACACACTCTTTGCTGGTGC
Connexin43 Forward: GTCGTGTCGTTGGTGTCTCT 60 291
Reverse: CACTCAGCGTGTCCAGTTCT
SCD Forward: AAGAGTGGCTGAGTTTCTGGTC 60 277
Reverse: GAAAGGAAGGTGATAGGGACAA
Zo1 Forward: AGATAGCCCTGCAGCCAAAG 60 117
Reverse: GGGAGGTCAAGCAGGAAGAG
MMP2 Forward: AACGCCATCCCTGATAACCT 60 126
Reverse: GCTTCCGAACTTCACGCTC
ITGB1 Forward: AGCACGGATGAGGTGAACAG 60 407
Reverse: CCAAGGCAGGTCTGACACAT
PAG11 Forward: AGCGTCGCCTACGAATCTG 60 120
Reverse: CTCAAACCCATATTCCGTCACA
CRYAB Forward: CACCCAGCTGGATTGACACT 60 147
Reverse: CCTCATGTTTGCCATGCACC
  1. aThe annealing temperature represents the optimal temperature during quantitative PCR.
  2. bRNA levels of GAPDH was assayed for normalization during quantitative PCR.