Skip to main content

Advertisement

Table 2 SRAP and SSR primers used to determine the rate of self-fertilisation

From: Evidence and consequences of self-fertilisation in the predominantly outbreeding forage legume Onobrychis viciifolia

Marker Forward primer (5′–3′) Reverse primer (3′–5′) Reference
SRAP me1 TGAGTCCAAACCGGATA em1 GACTGCGTACGAATTAAT Li and Quiros, 2001 [28]
SRAP me2 TGAGTCCAAACCGGAGC em2 GACTGCGTACGAATTTGC Li and Quiros, 2001 [28]
SRAP me3 TGAGTCCAAACCGGAAT em3 GACTGCGTACGAATTGAC Li and Quiros, 2001 [28]
SRAP me4 TGAGTCCAAACCGGACC em4 GACTGCGTACGAATTTGA Li and Quiros, 2001 [28]
SSR OVLegPl17_F GGGTGTTAGTTATCCATTTCC OVLegPl17_R ACATACTAGCCTTCTGGGGTA Mora Ortiz, “pers. comm”
SSR OVLegPl27_F AATGGAATCTCGGAGACAG OVLegPl27_R GGAAGAAGACGAAGTAGTAGGA Mora Ortiz, “pers. comm”