Skip to main content

Advertisement

Table 1 The primer sequences used for detecting the different CD40 SNPs

From: The association of CD40 polymorphisms with CD40 serum levels and risk of systemic lupus erythematosus

Reference SNP ID PCR primers
rs1883832C/T F:5'-GGACCTGGGGGCAAAGAAGA-3'
R: 5'- CCCACTCCCAACTCCCGTCT -3'
EF:5'-TTTTTTTTTTTTGCAGAGGCAGAC
GAACCAT -3'
rs1569723 A/C F: 5'- GGGATG GCCTGATCCAAAGG -3'
R: 5'- CCCACAGTCCACCACCCATC -3'
EF:5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTCGCTTTACACCCACAGCC-3'
rs4810485 G/T F: 5'- ATCCCCCAAGTACCTGGCTCCT -3'
R: 5'- CCTTGCTGCTTCCC TTGCTTTC -3'
EF:5'- TTTTTTTTTTTTTTTTTTTTTTTTTTT
TCCTACTTTAGAG GGCTGTAGATTCC -3'