Skip to main content

Table 1 Polymorphic SSR markers for genetic map construction

From: Identification and characterization of a high kernel weight mutant induced by gamma radiation in wheat (Triticum aestivum L.)

Markers Forward primer (5′–3′) Reverse primer (5′–3′) Annealing temperature (°C)
Xcau1022 CCTAACCATCCAACCATAAGT TTTCACGTACTCAAAAGTGG 55
Xcau1053 GGATGTACATTGAACAGTGCT CCCACCCTACTCACTTCAA 55
Xcau1074 ACCTAAAATCTTCCCCCTACT GCCAATTAATGCAGACTAGC 55
Xcau1087 GGAAAATCATGCACACATGG CCCCACCCTACTCACTTCAA 58
Xcau1118 TGTAATCCGTCTCCTACCTTAT GTCATACATGTCATCGGACTAC 55
Xcau1132 AGTCAATGAACAGAGCCATC CTTGACCTAGATAGGGAAACAA 55