Skip to main content

Table 1 Primer sequences for the quantitative real-time PCR amplification of the differential expressed genes in Shaziling and Yorkshire pigs

From: Integrative analysis of transcriptomics and proteomics of skeletal muscles of the Chinese indigenous Shaziling pig compared with the Yorkshire breed

Genes Primer sequences (5′-3′) Product size GenBank sequence no.
HSPB1 F: CGGCAGGATGAGCACGGCTTCA
R: GCGCCTCGAAAGTGACAGGGATGG
184 bp gi|55926209
ENO1 F: GGGGCCTCAACTGGGATCTACGA
R: TCCGTGCCGTCCATCTCAATCA
191 bp gi|753703906
ATP5B F: CCCTTCTGCGGTGGGTTAT
R: CACGGGACAGCACAGTGGTAG
188 bp gi|89574051
TPI1 F: CAGAGCACCCGCATCATTTACG
R: AAGCGCCACCCACAAGGAAC
100 bp gi|262263205
ACTC1 F: GGGGATGGCGTAACCCACA
R: GGCAAGGCATAGCCCTCGTAA
50 bp gi|545801458
MYLPF F: GGCGGCAACGTGGACTACAA
R: GGCCATCAAAGACCGAAGAGG
94 bp gi|117660856
ENO3 F: CGGGAAGGACGCCACCAAT
R: CCGTTGCGGTAGAACTCAGATGC
165 bp gi|113205498
ACTA1 F: TCAGGAAGGACCTGTATGCCAACAA
R: TGGACAGCGAGGCCAGGATG
186 bp gi|268607671