Skip to main content

Table 1 Primers for qualitative PCR markers

From: Development of chromosomal markers based on next-generation sequencing: the B chromosome of the cichlid fish Astatotilapia latifasciata as a model

Primer ID Primer sequence
49B1-F 5′ GAGCTTCACACTTGCAGAGGTAAGTCATTTTTGCAGAGAC 3′
49B2-F 5′ GCTTCACACTTGCAGAGGTAAGTCATTTTT 3′
49C + −F 5′ GTTTACAGTCTGATGATGGGACATCATGCTCTGC 3′
49-R 5′ TGTCCAGAGTATAATCGCAGCCTTTGCGGT 3′
80B-F 5′ GAGGCATTACATCGGTCTTTCCATCA 3′
80C + −F 5′ GGTGAGCAGCAGGATTTTGAATTGAATGCG 3′
80-R 5′ CCTGATTGAGTGCTTCTCACAC 3′
182B1-F 5′ GGGTGTGTTTGGTTGTGGTTTGACAAGGAGTG 3′
182B2-F 5′ GGAGTGAATTGTGATGGT 3′
182B3-F 5′ GGTTTGACAAGGAGTGAATTGTGATGGTTAGATC 3′
182B4-F 5′ GAGTGAATTGTGATGGTTAGATCACTAGGTAT 3′
182C + −F 5′ AGAATGGTCCAAGGAAGG 3′
182-R 5′ CCATCAGAACCAGCATTAA 3′
207B-F 5′ GAGACACTTCTTGGAGAAAATGAAATGCCCAC 3′
207C + −F 5′ ACCAGGCCAGGAGACGACTGAAGAACT 3′
207-R 5′ GACCTGCAGAAATGTGAACATGGTTGCAGTTTACAA 3′
323B-F 5′ GGGGGTGTTTTGCTTTTGGTTTTCCTACATTAGTTA 3′
323C + −F 5′ GTATAAGCCATCTCTGTCATCTAAGGTACA 3′
323-R 5′ GACACAGTACAGCTGACACAGACGAAGCAACAG 3′
764B-F 5′ CCTGAGATGGTCCGATTGGGCTGGTAA 3′
764C + −F 5′ GGTGAAGCATCAAAGAGCTCTCTGAGTCT 3′
764-R 5′ GGAGACAAGGAGATGCGTGTTGGTGAAGTCCTAA 3′
1100B-F 5′ GGGTGTGTGGAGATGTACATCAGCACACATGTT 3′
1100C + −F 5′ CACTGAGACGGCATTGGCATGAGAAA 3′
1100-R 5′ AGCATGGTGGCAGAGGTCTTTA 3′
1987B-F 5′ CCCTCCTGTTATTCATTCCCTA 3′
1987C + −F 5′ TACTTTGCTGTGTGTTTTGCCTGTC 3′
1987-R 5′ AAGTGTGGCTGTGTGCAGGCAGGAAT 3′
2519B-F 5′ GCAGGATTCAGGAGTGAAGCATCTGTGTGA 3′
2519C + −F 5′ CACTAAACTGCAGACATCAGGCTG 3′
2519-R 5′ CATTGTTCTGCTGCAGTCAATGGAC 3′
  1. The numbers 49, 80, 182, 207, 323, 1100 and 1987 are references to the contigs obtained with 454 sequencing data
  2. The letters B and C indicate the specificity of the primer as a B-specific primer or positive control (B or C+), respectively, followed by the reverse/forward annotation (F or R)