Skip to main content

Table 3 qPCR primer set designed over six high-coverage genomic regions

From: Development of chromosomal markers based on next-generation sequencing: the B chromosome of the cichlid fish Astatotilapia latifasciata as a model

Primer ID Primer sequence
Scaffold_3-F 5′ GCCACCATGTTCAGATTATTGGAGAGTA 3′
Scaffold_3-R 5′ AATGCCTGACTTATCCATGCCAGGTG 3′
Scaffold_13-F 5′ CGTTTTGTACGTCTGCTGGA 3′
Scaffold_13-R 5′ ACCGGTACCTGTGGTCTAGT 3′
Scaffold_19-F 5′ TGGAGCATGAGTCGAAAAGCA 3′
Scaffold_19-R 5′ TCGCAGAACAGTGTGAACCA 3′
Scaffold_26-F 5′ AGACGGGTCGGGATCTTACA 3′
Scaffold_26-R 5′ TGTTTGAGCATCCCCCAGAC 3′
Scaffold_31-F 5′ CCAAGGCTCAGGAAATAGGGG 3′
Scaffold_31-R 5′ ACCACTGCTTCTCAAAGAGGG 3′
Scaffold_324-F 5′ CAGGTCCCTCTGCGTAACTG 3′
Scaffold_324-R 5′ GACGCCCCAGTCATCATTCA 3′