Skip to main content

Table 1 List of HvSSR primers used for genotyping of 729 rice varieties along with their chromosomal position, product size, No. of alleles amplified, gene diversity, heterozygosity and PIC value

From: Genetic diversity trend in Indian rice varieties: an analysis using SSR markers

Chr. No. Primer ID Size (bp) Forward primer Reverse primer Major allele frequency Allele no Gene diversity Heterozygosity PIC
1 HvSSR01-32 250 AAACTGGAGATGAACTCGAA GTAACGAACTAGAGCATGGG 0.9445 2.0000 0.1048 0.0340 0.0993
  HvSSR01-41 348 TGAGTGAGACTTGACAGTGC AGTTAACACCAATGCTGACC 0.5943 3.0000 0.5405 0.2340 0.4638
  HvSSR01-53 274 TGTCGTCCACGTAGTAGGAG ACACTCCTCCTCTGTTCTCA 0.8894 2.0000 0.1968 0.0030 0.1774
2 HvSSR02-01 312 AAGAGATGAGAAGAGCAATGA CAACTTAGAGGAAGAAGGAGG 0.7813 2.0000 0.3417 0.0892 0.2834
  HvSSR02-33 355 TAATGCACGCACAACTTTAC TATAGAATGCTGACTGGGCT 0.7976 2.0000 0.3228 0.0923 0.2707
  HvSSR02-50 195 TTTCAGGAATCTGATGCTTT TTAATCAAAGCCCTAACAGC 0.6579 3.0000 0.5077 0.1445 0.4547
3 HvSSR03-02 228 TAGCGGAGTTGGAATAACAC CTGCACTGCATACCTCATAA 0.5346 4.0000 0.5737 0.9224 0.4922
  HvSSR03-10 280 GTACACAACGTCACAACAGC ACTGTGGCATATGTTCGATT 0.7566 2.0000 0.3683 0.1468 0.3005
  HvSSR03-19 230 AATTCAGTTCACGCATTCTT AGCTGTTCGTCTGCATAGTT 0.8968 2.0000 0.1851 0.0577 0.1680
  HvSSR03-37 386 GGAAATCGTCAAGAACGTC TAATTGTATACCACTCCGCC 0.3780 3.0000 0.6610 0.3013 0.5868
  HvSSR03-54 352 GCCTATCAGGCTATCATCAC GTGATCGACATTGAGGAGTT 0.8168 2.0000 0.2993 0.0049 0.2545
4 HvSSR04-19 265 TCGTGGAGTATCCTGTATCC TTATAACTTGGAGCTCAGGC 0.9127 3.0000 0.1631 0.1041 0.1566
  HvSSR04-27 318 ATGGATTTAGGCTTGTTTGA ATACTGCGAAGGTGAAGAGA 0.7150 4.0000 0.4609 0.2629 0.4319
  HvSSR04-46 179 GGCGCGCTTATATATGTACT CGATTGCGTGGTGTAACTAT 0.7774 4.0000 0.3712 0.1475 0.3413
5 HvSSR05-09 335 CTCTCCATCTTGCAATCTTC TGCATGACTCTATCAACCAG 0.5331 3.0000 0.5509 0.0768 0.4558
  HvSSR05-15 275 CCATGTCAAACGGTTACTTT GGGAGAAGTGAGAAAGAGGT 0.9366 3.0000 0.1205 0.0975 0.1166
  HvSSR05-30 353 TACGACGGACGATTAAAGTT GCTAACTCATTCATCTCGCT 0.7962 2.0000 0.3245 0.0000 0.2719
6 HvSSR06-03 212 CTAGGGAATCAGCGGTTAG GCTCTCTTGTCCTTCTTCTTC 0.9582 3.0000 0.0802 0.0099 0.0771
  HvSSR06-16 368 TCTGAAATGCTGTCATCAAG GAGCAGAGTAGGACATGAGC 0.9767 2.0000 0.0454 0.0186 0.0444
  HvSSR06-40 385 CTCTTCCGTGGTTAAAGAAA CACTGGTATGATCTCCGACT 0.5405 3.0000 0.5285 0.2859 0.4232
7 HvSSR07-18 343 GGTGTGTTGTCGAATCTCTC ATGCCATTGTCCTTACATTC 0.5436 3.0000 0.5383 0.1317 0.4392
  HvSSR07-51 341 CGAGCATGTCTGTCAAGTAA GTTCGAATGTAATGTTGGCT 0.8503 3.0000 0.2645 0.0349 0.2464
8 HvSSR08-14 295 TCCACTTTACATCGTCACAA CTACCTCTTAACCGCACATT 0.5996 3.0000 0.5401 0.0736 0.4661
  HvSSR08-19 221 CATCTCTTGAGAAATCTGCC TGTGCATTTCGTCTTTCATA 0.4944 4.0000 0.5183 0.1278 0.4022
9 HvSSR09-11 366 TGCAGAATTTCTTCCTTCAT ACCAGAATCTCCCAAATGTA 0.7632 5.0000 0.3981 0.0371 0.3752
  HvSSR09-26 331 TGGGCATCTGGTACTATCTT AGCTCATTCCACAGGTTAGA 0.9594 2.0000 0.0779 0.0056 0.0749
  HvSSR09-55 382 TTACTCCGCATATATCCATGT ATTTGACACCAAGTTGATCC 0.5925 4.0000 0.5090 0.7326 0.4105
10 HvSSR10-03 289 TCTTTCCCAAATTCCAGATA CATTAGTTGTTTGTGGCAGA 0.9081 3.0000 0.1711 0.0883 0.1641
  HvSSR10-13 169 CAGGGAATCAACATCAAAGT AGCAAGGCAAGTCATCTCTA 0.5795 4.0000 0.5292 0.4003 0.4378
  HvSSR10-34 202 TAGACCGAGGAATTGAAAGA TTTGGGCTTATTGTCAGTTT 0.9060 4.0000 0.1749 0.0982 0.1681
11 HvSSR11-13 285 TGAAACCACAATGAGTCAAA GCCCTAAACCCAAATAGAAG 0.7532 2.0000 0.3718 0.1062 0.3027
  HvSSR11-21 291 TACGCTATAACCATGAAGCA CTCCCGTTATTGTCCTTACA 0.8305 5.0000 0.2962 0.2161 0.2766
  HvSSR11-58 371 ACTGAATCCTTACTGGAGCA GGAGATAAGCATTTGGAAGA 0.7881 5.0000 0.3639 0.1607 0.3451
12 HvSSR12-01 271 GATTTGCAACACGTACGATA GATCATCCACTCTGAGCAAT 0.9203 2.0000 0.1467 0.0986 0.1360
  HvSSR12-13 388 ACCTTAGGGCTGAGTTCTTT TTAGGCTTGTCTCTTCCTCA 0.9048 5.0000 0.1782 0.0710 0.1733
  HvSSR12-39 289 ATCTAACAACAACAATCCCG CATCTTCATCCCTCGTGTAT 0.8793 4.0000 0.2211 0.1142 0.2124
  Mean     0.7630 3.1111 0.3346 0.1536 0.2917