Skip to main content

Advertisement

Table 1 Primers used for PCR amplification of the fragments of nuclear and mitochondrial genes

From: Genetic diversity among eight Dendrolimus species in Eurasia (Lepidoptera: Lasiocampidae) inferred from mitochondrial COI and COII, and nuclear ITS2 markers

DNA fragment Primers Sequence Source
3′ end of COI gene M5 5′- CAACATTTATTTTGATTTTTTGG-3′ [2]
M3 5′- CCAATGCACTAATCTGCCATATTA-3′ [2]
5′ end of COI gene 911 5′-TTTCTACAAATCATAAAGATATTGG-3′ [44]
912 5′-TAAACTTCAGGGTGACCAAAAATCA-3′ [44]
Portion of COII gene C2N 5′- CCACAAATTTCTGAACATTGACCA -3′ [45]
C2J 5′- AGAGCTTCTCCTTTAATAGAACA -3′ [45]
ITS2 ITS2A 5′- TGTGAACTGCAGGACACAT -3′ [2]
ITS2B 5′- TATGCTTAAATTGAGGGGGT -3′ [2]