Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used for PCR amplification of the fragments of nuclear and mitochondrial genes

From: Genetic diversity among eight Dendrolimus species in Eurasia (Lepidoptera: Lasiocampidae) inferred from mitochondrial COI and COII, and nuclear ITS2 markers

DNA fragment Primers Sequence Source
3′ end of COI gene M5 5′- CAACATTTATTTTGATTTTTTGG-3′ [2]
5′ end of COI gene 911 5′-TTTCTACAAATCATAAAGATATTGG-3′ [44]
Portion of COII gene C2N 5′- CCACAAATTTCTGAACATTGACCA -3′ [45]