Skip to main content

Advertisement

Table 1 List of primer-pairs developed and used to amplify the SSR loci in this study

From: Genetic structure and relationships within and between cultivated and wild korarima [Aframomum corrorima (Braun) P.C.M. Jansen] in Ethiopia as revealed by simple sequence repeat (SSR) markers

Locus SSAN Primer sequence (5-3) Repeat motifs Expected size Observed repeat Motifs Allele size rangea
Afco_2 JX422069.1 F TTGACTTGGGTATGGCAAAA (AG)13 230 - 212–242
R AAGGTCGAGCAGGAGTAGCA
Afco_3 JX422068.1 F GAATTCATGTTCTTGAGAAAAGTTTG (AG)7 198 (GA)2 191–200
R GCCAAATGAACGGACAGATT
Afco_5 JX422066.1 F TGACTCCAAACTTGCAGGAG (CT)8 160 (CT)12 160–171
R AGCAGATCAATGCACGTGAG
Afco_6 JX422065.1 F TCGACATGAAATCCCTACGAGA (AG)15 243 (AG)12 230–253
R GAGCTGTGAAGTGAAAGGGC
Afco_8 JX422063.1 F GCTAACTTGTCTTTCCTATTTCTCC (CT)13 239 * 229–245
R TGGAAGCTGCATTCACTGAG
Afco_11 JX422060.1 F AATGCTTCTAGCTGGTTCGAC (GT)7 241 (GT)6 240–260
R CCTTGAATTTTATATTTCTTCCAGATG
Afco_14 JX422057.1 F CCTTCCACGGTGTCTCATTT (GA)19 281 (GA)10 280–285
R TCATCCAAAACTTCAATCATGG
Afco_15 JX422056.1 F ATCGATGGGATCGCCTTAC (GA)19 292 (GA)9 256–262
R GACGTCACGAATGTTGGTTG
Afco_19 JX422052.1 F CAGACGAGAGGAGGGAGATG (GA)17 373 (GA)9 356–364
R CTCTGTGAGCCGTTCAATCC
Afco_21 JX422050.1 F CGACAAGGAGGAGAAGAGGT (GA)14 250 (GA)6 GAAAGG (GA)7 250–260
R CCAACAGCCCTTCTTTTTGA
Afco_22 JX422049.1 F GAAGAAGCGTTGGTGAGAGG (TC)20 468 (TC)9 449–455
R CTGTGTCGTCCAGCCGTATT
  1. a= refers to allele size across all individuals included in the study; SSAN source sequence accession number; *= The SSR are located in the trimmed (low quality) part of the sequence and hence the length of the repeat motif could not be determined; − = sequencing failed