Skip to main content

Table 1 Sequences of gRNAs complementary to target sites flanking the Cntn6 gene and ssODN

From: Generation of megabase-scale deletions, inversions and duplications involving the Contactin-6 gene in mice by CRISPR/Cas9 technology

gRNA Sequences (5′ - 3′) Target positions for gRNAs
gRNA-1 GAGCACATGGTAAACGCAGG(AGG) chr6: 103,842,565-103,842,587: «-»
gRNA-2 GGTAATATAGTGCGCCAAAG(AGG) chr6: 104,979,795-104,979,817: «-»
ssODN 5’GGTCCTTGGAGAGGAACATGGCCTTGCTTCTGTGCAGTCTTCCATCCTCAGTGGCCTCCTTGGCGCACTATATTACCTAATCCATTTTTCAGCATCCAAGATATTTTAAAGAAGAAGAAA3’ « + »