Skip to main content

Table 3 Primers used for genotyping F0 offspring with deletions, duplications and inversions

From: Generation of megabase-scale deletions, inversions and duplications involving the Contactin-6 gene in mice by CRISPR/Cas9 technology

Primers Sequence (5′ - 3′) Positions on mouse chromosome 6
FWD1.1 TGGGTCCTTGGAGAGGAACA chr6: 103,842,509-103,842,528
FWD1.2 ACTCTGGTGACAATGTGCGT chr6: 103,841,824-103,841,843
REV1 TGCACATGACCCATGACCTC chr6: 103,842,786-103,842,767
FWD2.1 TCCCCATCTGCTGGCTCTAT chr6: 104,979,678-104,979,697
FWD2.2 AGAGGTTGATGCAAGCTGCC chr6: 104,979,540-104,979,559
REV2 CCCCCAAGTGATGCTTCTGT chr6: 104,980,355-104,980,374
FWD-SNP TTGCCCTGGTTGTCTTTTATTCAT chr6: 104,847,831-104,847,854
REV-SNP AGCACAAACCATGTCACCAAG chr6: 104,848,314-104,848,334