Skip to main content

Advertisement

Table 2 Real-time PCR primers used in this study

From: De novo transcriptome sequencing and analysis of male and female swimming crab (Portunus trituberculatus) reproductive systems during mating embrace (stage II)

Gene Name Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′)
β-actin ACTGGGACGACATGGAGAAGATC AAACCTTACCACTCCCGCC
ADRA1B TCTGGTCGCTGTGCGTGAT ATCAAGACCACCAAGACATCCG
ARL3 CATCCCTTGCTCTACATTACTTCC AAACGACGGGTGCCACAG
BAP1 ACCCGCACTCCTCCCTTAT GAGAACCAAGTGGAGCAGACA
TRPA1 AGTAGCGGCAACATGTCCACC CCAAACTAACCCTGAAAGACCG