Skip to main content

Advertisement

Table 1 Primers for mutational hot spot amplification of beta-globin gene

From: High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh

Sl No Primer name Primer sequence(5′ → 3′) Primer size
1 HBB_Ex1F GGCAGAGCCATCTATTGCTTAC 22
2 HBB_Ex2R CAGGCCATCACTAAAGGCACC 21